The glassy-winged sharpshooters (GWSS) maintenance
The Glassy-Winged Sharpshooters (H. vitripennis) were collected from crepe myrtle, Lagerstroemia sp. trees planted in parking lot 9 of UC, Riverside. These GWSS were kept on basil plants until they were used. A laboratory-based method for propagation of GWSS is not yet available, necessitating use of field-caught arthropods.
Bacterial strains, culture conditions
Escherichia coli strain XL1-Blue was used to maintain plasmids and for gene cloning. Pantoea agglomerans E325, an EPA approved biological control agent, was used to express and deliver different AMP molecules inside the GWSS gut. Both E. coli and P. agglomerans were grown in Luria Bertani agar or broth. P. agglomerans and E. coli were cultured on agar plates at 30 °C and at 37 °C, respectively. Broth cultures were grown at the same temperatures in a shaker incubator (200 rpm). Carbenicillin or chloramphenicol was added at a concentration of 100 μg/mL and 35 μg/mL, respectively, when needed. Two plasmids that were used in study pEHLYA2-SD and pVDL9.3 have carbenicillin or chloramphenicol resistance markers, respectively.
X. fastidiosa Temecula strain was used in this study and was cultured in PD3 agar at 28 °C or in PD3 broth at 28 °C. The culture was agitated at 175–200 rpm to grow X. fastidiosa in broth culture.
Plant inoculations
X. fastidiosa strain Temecula was grown in PD3 medium using the conditions as described previously. The bacteria were harvested in log phase and washed thrice with PBS before resuspending in PBS and brought to an O.D. 600 of 0.25, which is an equivalent of 108 cells/ml. Twenty μL of bacterial suspension was inoculated twice into the vine using a needle. The stem was pricked above the second leaf using the needle and one drop of X. fastidiosa suspension (2X106) was placed on the point of inoculation; the negative pressure of xylem internalized the bacterial suspension. The plants were kept for 15 weeks before they were used.
MIC and MBC of AMPs against P. agglomerans and X. fastidiosa
P. agglomerans was grown in LB broth at 200 rpm in a shaker incubator at 30 °C for 16 h. Afterwards P. agglomerans was diluted 1/100 in 3 mL LB broth and grown at 30 °C to mid-log phase. At mid-log phase the bacteria were diluted in LB medium to 105–106 colony forming units/mL (CFUs/mL). Ninety μL of diluted P. agglomerans were pipetted into sterilized 0.2 mL PCR tubes and to this 10 μL of 10X test concentration of either melittin or SLM (both synthesized by China Peptides, Shanghai, China) was added. These tubes were incubated at 30 °C and after 16 h of incubation OD 600 was determined to ascertain MIC (minimum inhibitory concentration) of AMPs against P. agglomerans.
X. fastidiosa strain Temecula was grown in PD3 medium in a shaker incubator at 28 °C and 200 rpm until it reached its log phase. Afterwards the X. fastidiosa culture was diluted to a concentration of 105–106 CFUs/mL in PD3 medium. Ninety μL of diluted X. fastidiosa were mixed with 10 μL of 10X test concentration either AMP in a sterilized 0.2 mL PCR tube and was incubated at 28 °C in a shaker incubator for 16 h. X. fastidiosa is a slow growing bacterium, which makes measuring change in OD 600 of overnight cultures unfeasible. Hence, after treatment with AMPs X. fastidiosa was plated on to PD3 agar to determine MBC (minimum bactericidal concentration) of AMPs against X. fastidiosa. These plates were incubated at 28 °C for 10 days and CFUs were counted. The toxicity assays were repeated twice with three replicates for each dose in each experiment.
Plasmid construction
Sense and antisense sequences of the melittin gene with NheI and XmaI overhang were ordered from IDT (Coralville, Iowa, USA) and were annealed to themselves by lowering the temperature by 1 °C/min from 95 °C to 50 °C.
Scorpine like molecule (SLM), an AMP from Vaejovis mexicanus venom, gene was amplified from a plasmid (kindly provided by Dr. Lourival D. Possani) using forward primer (ScoHlyAF1.1) CAGCTAGCGGTTGGATAAGCGAG; and reverse Primer (ScoHlyAR1.1) TTTTTTATAGGCACGGGGTATACC. The product was cut using restriction enzymes NheI and SmaI.
The plasmid pEHLYA2-SD (kindly provided by Dr. Luis A. Fernandez, National Center for Biotechnology, Madrid, Spain) - having the hlyA secretion signal of the E. coli hemolysin secretion system and bla (β-lactamase) gene as marker- was also cut using restriction enzymes NheI and SmaI. Melittin or SLM genes were ligated into linearized pEHLYA2-SD plasmid (Additional file 2: Figure S2). The in-frame presence of both melittin and SLM genes was confirmed by sequencing. The in frame insertion of melittin or SLM gene resulted in plasmid pEHLYA2-SD-Mel or pEHLYA2-SD-SLM.
P. agglomerans transformation
P. agglomerans was cultured in LB broth and grown to an OD600 of 0.6–0.7 (mid-log phase). These cells were centrifuged at 4 °C and 8000 rpm for 10 mins and supernatant was removed. The cells were washed with ice cold autoclaved water. The final cell pellet of competent cells was re-suspended in 1 mL 10% glycerol. Eighty μL of competent cell suspension were aliquoted into microcentrifuge tubes. One μL of pVDL9.3 (chloramphenicol resistance as marker) plasmid was added to 80 μL of competent cells and transferred to an ice cold 1 mm cuvette. These cells were electroporated at 2.0 kV, 25 microF. The cells were then plated onto chloramphenicol-containing LB agar. Sixteen hours after plating the colonies were selected and presence of plasmid was confirmed.
pVDL9.3 plasmid-containing P. agglomerans cells were made competent using the above mentioned protocol and were transformed with plasmid pEHLYA2-SD or pEHLYA2-SD-Mel or pEHLYA2-SD-SLM. P. agglomerans containing both the plasmids were selected on LB agar containing carbenicillin and chloramphenicol.
Anti-melittin bleed production and ELISA
The anti-melittin bleeds were produced by GenScript (Piscataway, NJ, USA) using manufacturer’s standard protocol (https://www.genscript.com/custom-rabbit-polyclonal-antibody-service.html). Once the bleeds were received the ELISA was conducted on dilutions of melittin ranging from 30 nM to 10 μM. Hundred μL of each dilution was pipetted into the wells of 96-well plate in triplicate. The plate was sealed using plastic wrap and incubated at 37 °C for 2 h. After the incubation the wells were washed 3 times with 250 μL TBST (tween 20 + tris-buffered saline). After washing, the wells were filled with 250 μL of 2.5% BSA (bovine serum albumin)-TBST and sealed. After 2 h of incubation at room temperature the wells were washed three times with 250 μL TBST before adding 100 μL of anti-melittin bleed (1:5000 dilution in TBST) in each well and sealed. The plate was incubated at room temperature for 2 h. Afterwards the plate was washed with 250 μL TBST 3 times and 250 μL of secondary antibody (goat-anti rabbit,1:5000 dilution in TBST) was added, sealed and covered with aluminum foil. The plate was incubated for 1 h at room temperature. After incubation the plate was washed three times with 250 μL TBST and 100 μL of TMB (3,3′,5,5’-Tetramethylbenzidine) was added and covered with aluminum foil. After 30 min of incubation at room temperature the reaction was stopped by adding 100 μL of 18 M H2SO4 per well and the plate was read at 450 nm. The lowest detection limit of the bleed was 1 μM (Additional file 4: Figure S4).
Detection of melittin and SLM in spent medium
P. agglomerans grown in LB for 16 h was centrifuged at 10000 rpm and the supernatants were collected. The supernatant from each culture was concentrated using 10 kDa NMWL filter (EMD Millpore, Temecula, CA, USA). Twenty μL of concentrated spent medium was mixed with 5 μL of loading dye and run on a 8–16% precast polyacrylamide gel (Biorad, Hercules, Califirnia, USA) at a constant electric potential of 150 V. The proteins were then transferred to a nitrocellulose membrane. The nitrocellulose membrane was first incubated with primary rabbit anti-E-tag antibody (Abcam, Cambridge, MA), which was diluted to 1:1000 in 10% milk-TBST, at room temperature. This membrane was washed 5 times with TBST and incubated with mouse anti-rabbit antibody with AP (alkaline phosphatase) conjugate, which was diluted in milk-TBST to 1:5000. This membrane was washed 5 times with TBST and was developed using NBT (nitro blue tetrazolium) and BCIP (5-bromo-4-chloro-3-indolyl-phosphate).
Presence of melittin in the supernatant was reconfirmed using rabbit anti-melittin bleed using the protocol as mentioned above. Anti-melittin bleeds were generated by injecting five rabbits with synthetic melittin and subsequently testing activity of bleeds harvested from these rabbits against melittin via ELISA.
X. fastidiosa transmission blocking assays
P. agglomerans lines were cultured in LB broth for 16 h and cultures were washed twice with PBS. After washing, 1010 CFUs of P. agglomerans lines were suspended in 3 mL PBS. Each suspension was mixed with 20 mL 3% guar gum (w/v). One mL glycerol and 500 μL India Ink were added to it before this slurry was painted on to grape stems (cv: Chardoney). The plants were kept overnight to let the guar gum dry. These plants were then covered with sleeve cages and field collected GWSS were released on these plants. The sharpshooters were kept on these plants for 48 h before putting them on X. fastidiosa-infected plants for another 48 h. After acquisition access of 48 h on X. fastidiosa-infected plants, the GWSS were collected and two of these GWSS were confined on naive grape plants for 24 h. The insects were removed after 24 h, surface sterilized and DNA was extracted before running real-time PCR. The inoculated grape plants were kept in the greenhouse for 30 weeks and were tested for X. fastidiosa infection via real-time PCR. The experiments were conducted according to the institute guidelines. The experiment was repeated independently and the results were pooled together.
DNA extraction from the insect head
The GWSS were surface sterilized by washing in 70% ethanol for 2 mins followed by in 10% bleach for 2 mins and rinsed twice in sterilized water for 2 mins. The heads were removed from the sterilized GWSS using a surgical blade. The GWSS heads were then homogenized in 200 μL PBS using a Kontes homogenizer and DNA was extracted using DNeasy Blood and Tissue Kit (Qiagen, Valencia, CA, USA) following manufacturer’s instructions.
DNA extraction from plant tissues
After 30 weeks of inoculation, stems of 10 cm were cut from the plants. These stems were sterilized by washing in 70% ethanol and 10% bleach for 2 mins each, followed by 2X washing in sterilized water for 2 mins. These stems were put in Adagia bags (Elkhart, IN, USA) and homogenized in 800 μL of lytic buffer (20 mM Tris-Cl pH 8.0, 70 mM sodium EDTA, 2 mM sodium chloride, 20 mM sodium metabisulfite) using mortar and pestle. Two hundred μL of plant tissue suspension in lytic buffer was placed in a 1.5 mL microcentrifuge tube. Each suspension was incubated at 55 °C for 1 h after adding 40 μL of 5% sodium sarkosyl and 1.5 μL of proteinase K. After 1 h of incubation this suspension was centrifuged at 13000 rpm for 15 mins and supernatant was collected. DNA was purified from the supernatant using a GeneClean kit (MP Biomedicals, Santa Ana, CA, USA) following manufacturer’s instructions.
Real-time PCR
We used ITS-specific primers and probes described in Schaad et al. [37] to run real time-PCR. The 20 μL reaction was performed in 0.1 mL strip tubes containing 10 μL 2X IQ Supermix (Biorad, Hercules, CA), 100 nM forward primer, 200 nM reverse primer, 200 nM Taqman probe with dye, 5.8 μL of PCR-grade water and 2 μL of template DNA. The real-time PCR was performed on the Eppendorf Realplex at 95 °C for 3 mins for enzyme activation followed by denaturation at 95 °C for 15 s, and extension and annealing at 62 °C for 1 min. The PCR was run for 40 cycles.
Detecting accumulation of AMPs inside the insect body
The Glassy-Winged Sharpshooters were surface sterilized as mentioned above. The whole GWSS were then homogenized in PBS using a Kontes homogenizer. The homogenized solution was then centrifuged at 13,000 rpm for 10 mins and supernatant was used for AMP detection. Twenty μL of supernatant was mixed with 5 μL of reducing marker and was run on precast Mini PROTEAN TGX gels (Biorad, Hercules, Califirnia, USA). Proteins were transferred on to nitrocellulose membranes as mentioned above and accumulation of protein was detected using primary rabbit anti-E-tag antibody as mentioned above.
Accumulation of melittin inside the insect body was confirmed using rabbit anti-melittin serum. The protocol for Western blot is mentioned above.
Statistical analysis
Chi-square tests for homogeneity were employed to compare number of GWSS carrying X. fastidiosa in their foreguts. X. fastidiosa CFUs present in GWSS foregut in various treatments were analyzed by Tukey’s test for multiple comparisons after taking log values of CFUs. All values are shown as mean ± S.E. Statistical analyses were performed using Minitab version 17 for windows8. p values< 0.05 were considered significant.
