Strain isolation, growth and characterization

Halophilic archaea isolated from the upper gray crystals (GC) and the deeper black mud (BM) strata grown in enriched medium were characterized as disc-shaped (0.2 × 0.8 mm), motile Gram-negative microorganisms. Differentially, GC and BM colonies exhibited orange-red and reddish pigmentation, respectively. However, when grown in basal medium, a mixture of pleomorphic rods and disc-shaped motile archaebacteria displaying undefined Gram staining was observed.

For each isolate, a nearly complete 16S rDNA gene region (1300 bp) was sequenced (GenBank accession numbers GQ182977 and GQ182978) and compared with the same segment from other halophilic archaea. Phylogenetic analyses showed that both isolates belong to the Archaea domain and are related to the Halorubrum cluster, with the highest similarity to Halorubrum tebenquichense (98%). The G+C contents of the two isolates and the reference strain ALT-92T [15] were determined. BM and GC had a G+C content of 59.5 and 61.7 mol%, respectively (Table 1), whereas ALT-92T presented 63.2 mol%. On the basis of the ad hoc committee recommendations [16, 17] of a threshold value of 70% DNA-DNA similarity for the definition of bacterial species, the two strains formed an homogeneous cluster with a high degree of internal similarity (DNA-DNA similarity > 90.5%) and should be considered as members of the same H. tebenquichense species.

The random amplified polymorphic DNA (RAPD) or arbitrarily primed polymerase chain reaction (AP-PCR) DNA fingerprinting technique provides one of the most sensitive and efficient of current methods for distinguishing different strains of a species [18]. In order to corroborate such differences between the two isolates, AP-PCR fingerprint analysis was performed (Figure 1). The band pattern showed visible differences between BM and GC fingerprint (absence or presence of 2, 4, 6 and 7 bands), in concordance with biochemical tests and 16S rDNA sequence data. In sum, differences in fructose metabolism, utilization of starch and optimum growth conditions (Table 1), together with those revealed by the AP-PCR, suggested that BM and GC isolates were different not only from those described for H. tebenquichense ALT-92 T [15], but also between each other and could be classified as new H. tebenquichense strains.

Lipid extraction and characterization

The TPL, defined as the acetone insoluble portion of the total lipids, extracted from frozen cells obtained from a batch of 8 litres, ranged between 90 and 120 mg for each isolate.

A high content of phosphate groups is reported in the literature for the Halorubrum genus. Hence, for TPL quantification two colorimetric methods were applied: one, for detecting total phosphate (Bötcher) and the other for detecting organic phosphate (Stewart). Two calibration curves were prepared employing dry mass of TPL as standards that resulted linear between 10-40 μg for Bötcher and 20-400 μg for Stewart, with correlation coefficients exceeding 0.997, for each source of TPL.

On the other hand, calibration curves using inorganic phosphate (NaH₂PO₄) as standard were prepared with the aim of determining the phosphate percentage of archaeal lipids by the Bötcher method. A linear plot of dry mass of TPL vs. μg inorganic phosphate was determined and the relative amount of phosphate in the extracted TPL was similar for both isolates, in the order of 6.25% w/w.

ESI -MS polar lipids profile

The ESI-MS spectrum (negative ions) analyses of the TPL of H. tebenquichense, BM and GC showed three main peaks at m/z 805, 899 and 1055.9 (Figure 2). In addition, GC displayed intense ion peak at m/z 1521 that was less intense for H. tebenquichense and BM extracts. The peaks at m/z 731.5 (diagnostic of PA) and 886 (PGS) that were reported for Halorubrum sp. [19] could not be detected in any of our samples. Negative ion ESI-MS (Figure 2A, B and 2C) identified major signals corresponding to PG m/z 805.7, PGP-Me m/z 899.5 (as monocharged peak), 449 (as bicharged peak) and S-DGD m/z 1055.7 (as monocharged peak). The diagnostic peak of archaeal cardiolipin (BPG) at m/z 760 (as bicharged peak) and 1521 (monocharged peak) was detected only as a small signal in the three TPL extracts.

ARC characterization

As revealed by transmission electron microscopy, the two ARC preparations were multilamellar, with a mean size of 564 ± 22 nm and zeta-potential near to -50 mV. BSA incorporation did not modify size or zeta potential, the protein/lipid ratio was 20 μg/mg and the encapsulation efficiency around 3-4%.

ARC uptake by cells and cellular toxicity

None of the ARC or HSPC:cholesterol liposomes significantly reduced the viability of non phagocytic cells (Vero cell line) upon 24 h incubation (Figure 3A). On the other hand, 10 μg/ml ARC-GC was non cytotoxic but the higher concentrations reduced cell viability by 25%, while increased concentrations (up to 100 μg/ml) of ARC-BM and HSPC:cholesterol liposomes did not affect cultured macrophages (J-774 cell line) (Figure 3B).

As shown in Figure 4A, and independently of the TPL source, a minimal time period of 30 min was required for ARC uptake by phagocytic cells, as judged by the detection of intracellular fluorescence after incubation with both ARC-HPTS/DPX. In addition, J-774 macrophages incubated 45 min with both ARC- HPTS/DPX showed punctual fluorescence (as shown by arrows in Figure 4A) that resulted from the confinement of the HPTS/DPX into vesicular compartments in the cytoplasm. In case membrane fusion between ARC and the phagosome occurred, the ARC inner content should be released to the cytoplasm. Consequently, the HPTS would be dequenched from DPX and an homogeneous brightness filling the cytoplasm should be observed [20, 21]. However, the punctual emission upon excitation at 440 nm, indicating confinement of the pair HPTS/DPX in acidic compartments, remained unchanged. Hence, the ARC did not fuse/disrupt, staying inside the phagosomes for at least 60 minutes (Figure 4B).

Antibody response

To evaluate the adjuvant activity of both ARC formulations, we tested the antigen-specific humoral immune response after immunization of mice with BSA-loaded ARC. Following sc inoculations at 0 and 21 days, mice responded by day 28 with similar anti-BSA antibody (total IgG) titers for both ARC-BM/GC-BSA (Figure 5A), and presented a strong enhancement (~2 log, p < 0.01) of antibody titers over those of BSA and BSA-Al groups. Immunization with either empty ARC-BM/GC failed to evoke any anti-BSA IgG response, whereas only one out of four mice receiving adjuvant-free BSA displayed detectable specific antibodies. Mean titers in ARC-BM/GC-BSA groups were sustained until at least day 60 and declined by day 135. In all cases, very little anti-BSA IgM reactivity was detected throughout the study (data not shown).

To investigate the ability of ARC to generate long-term memory immunity, a boost-dose with BSA alone was injected on day 180. Three weeks later, a significantly higher serum antibody response (>1 log, p < 0.05) was detected in ARC-BM/GC-BSA compared with the BSA group (Figure 5B).

We further examined the IgG isotype distribution in the sera of immunized mice on day 200. Both IgG1 and IgG2a increased antibody titers could be demonstrated in long-term responses from ARC-BM/GC-BSA groups (Figure 6).

Materials

Sodium 3'-[1-(phenylamino-carbonyl)-3,4-tetrazolium]-bis-(4-methoxy-6-nitro) benzene sulfonic acid hydrate (XTT), bovine serum albumin (BSA), antifoam 204 and cholesterol were provided by Sigma-Aldrich (Argentina). Hydrogenated phosphatidylcholine from soybean (HSPC) was obtained from Northern Lipids (Vancouver, Canada). RPMI 1640 culture medium was purchased from Invitrogen Corporation. Endotoxin-free fetal bovine serum (FBS) was bought from Hyclone. L-Glutamine, Trypsin, EDTA and penicillin/streptomycin were provided by PAA Laboratories GmbH (Austria). The fluorophore 8-hydroxypyrene-1,3,6-trisulfonic acid (HPTS) and the quencher p-xylene-bis-pyridinium bromide (DPX) were purchased from Molecular Probes (Eugene, OR, USA). Halorubrum tebenquichense strain ALT6-92 was purchased from Deutsche Sammlung von Mikroorganismen and Zellkulturen (DSMZ). Tris buffer and all the other analytical grade reagents were from Anedra (Argentina).

Culture growth and characterization

Soil samples were collected from Salina Chica, Península de Valdés, Chubut, Argentina. Samples were classified according to their strata source as upper grey crystals (GC) and deeper black mud (BM). Isolation of microorganisms from each strata was done by seeding an aliquot on basal growth medium [48] with 1.6% agar (solid basal medium) at 37°C. The resulting colonies were grown on liquid medium at 40°C, at 160 rpm with chloramphenicol (30 mg/l) and then seeded on solid basal medium or brain-heart broth supplemented with yeast extract, glucose or blood (enriched medium).

Optimal NaCl concentration, pH, temperature and Mg⁺² requirements for growth were determined as described by Oren [49]. Gram staining as described by Dussault [50], cell shape and pigmentation examined by optical microscopy, were performed on colonies grown in basal medium and also in medium supplemented with blood or with brain-heart broth. Standard biochemical test methods were assessed for each colony.

Salt requirement for maintaining stability of the cell envelope was determined as described by Oren [49] by measuring the loss of turbidity of cell suspensions in medium of decreasing concentrations of NaCl (8, 6, 4, 2 and 0% w/v).

Biomass was generated in 8 l batch cultures in basal medium supplemented with yeast extract, glucose and antifoam (20 μl/l). Cultures were monitored by absorbance at 660 nm and harvested in late stationary phase for storage as frozen cell pastes.

DNA isolation, G+C content

The DNA was isolated using a French pressure cell (Thermo Spectronic, Rochester, NY) and was purified by chromatography on hydroxyapatite as described [51]. The G+C content (mol%) of the DNA was determined by the midpoint value of the thermal denaturation profile (Tm) with a Perkin Elmer spectrophotometer at 260 nm, programmed for temperature increases of 1.0°C/min [52]. Tm was determined by the graphic method described by Ferragut and Leclerc [53] and the G+C content was calculated using Owen and Hill's equation (1979).

PCR amplification of the 16S rDNA gene coding sequence and sequencing

Purified genomic DNA was used for PCR amplification of the16S rDNA gene. The following two sets of primers were used on the basis of the highly conserved regions of halobacterial 16S rDNA sequences as described by Ihara [48]: f1 (5' ATTCCGGTTGATCCTGC 3'), r1 (5' TTTAAGTTTCATCCTTG 3') and f2 (5' AACCGGATTAGATACCC 3'), r2 (5' GTGATCCAGCCGCAGATTCC 3'). PCR was performed with 35 cycles of 30 s at 94°C, 30 s at 37°C and 90 s at 72°C. The PCR products were analyzed by 1.5% agarose gel electrophoresis. The products were purified from the gel using S.N.A.P.™ Gel Purification Kit (Invitrogen) and sequenced directly by the dideoxy chain termination method [54].

Phylogenetic analysis

The obtained sequences were compared with previously described 16S rDNA sequences of halophilic archaeas from the NCBI database. The sequences were aligned by using CLUSTAL X 1.83 [55, 56] and phylogenetic trees were constructed by the neighbour-joining method with Kimura two-parameter calculation in MEGA 3.1 software. The confidence levels for branching orders were evaluated by the bootstrap method [57].

DNA-DNA hybridization

DNA-DNA hybridization studies were performed as described by De Ley [58] under consideration of the modifications described by Huss [59] using a Cary^® 100 Bio UV/VIS-spectrophotometer equipped with a Peltier-thermostatted 6 × 6 multicell changer and a temperature controller with in-situ temperature probe (Varian, Inc).

DNA Fingerprint

DNA from the isolates was used for arbitrarily primed PCR (AP-PCR) fingerprint assay. Three small primers were used: T3GC (5' CCCAKTCGTGAWTCATGCT 3'), T3R, (5' TCCTCAYTTAATNAMCATGCT 3') and Rsh (5' ATCAAAAT 3'). PCR was performed for 35 cycles, starting with 10 s of denaturation at 92°C followed by 60 s of annealing at 30°C and 90 s of elongation at 72°C. The reaction mixture contained 10 ng of genomic DNA, 3 mM MgCl₂, 1 μM of each primer, 0.2 μM of dNTPs, and 2 U of Taq Polymerase (Invitrogen) in a final volume of 20 μl. The PCR results were visualized in a 1.5% agarose gel electrophoresis and analyzed by Image Kodak Software.

Lipid isolation

Lipids were extracted by the method of Bligh and Dyer as modified for extreme halophiles [60], from frozen and thawed biomass of each colony with Cl₃CH:CH₃OH:H₂O (1:2:0.9; v:v), and the total polar lipid (TPL) fraction was collected by precipitation from cold acetone. Phospholipids of the TPL were quantified by Bötcher [61] and Stewart [62] methods.

ESI-MS analysis

ESI-MS analysis was performed using a Thermo Finnigan LCQ Ion Max mass spectrometer (Thermo Finnigan MAT, San Jose, CA, USA) equipped with a electrospray ionization source. Analyses were carried out in the loop injection mode with dried lipid extracts dissolved in chloroform-methanol (1:1 vol/vol). Samples (5 μl) injected via a 10 μl loop were transferred to an MS electrospray interface (ESI) at flow rate of 10 μL/min. Interface conditions were as follows: nebulizer gas (air) 12 l/min, curtain gas (nitrogen), 1.2 l/min needle voltage - 5.0 kV (negative ions), mass range 50 - 2000 amu.

ARC preparation and physicochemical characterization

Two different types of ARC were prepared from TPL isolated from each colony: ARC-GC and ARC-BM. Briefly, 20 mg of TPL from CHCl₃: CH₃OH (9:1, v/v) solution was rotary evaporated at 40°C in round bottom flask until organic solvent elimination. The thin lipid film was flushed with N₂ and hydrated at 40°C with 1 ml of 10 mM Tris-HCl buffer plus 0.9% w/v NaCl, pH 7.4 (Tris buffer) (empty ARC) or with 1 ml of 10 mg/ml BSA solution in Tris buffer (ARC-CG/BM-BSA). The resultant suspensions were sonicated (20 min in a bath type sonicator 80 W, 40 KHz) and submitted to 5 cycles of freeze/thaw between - 80 and 37°C. Free BSA was removed by centrifugation and washing with Tris buffer (10000 × g for 20 min). Liposomes made of HSPC:cholesterol (1:1 mol:mol) were prepared in the same way.

The BSA/phospholipid weight ratio from each preparation was determined by phospholipid and protein quantitation. Phospholipids were quantified by Bötcher [61] whereas BSA content was measured by Bradford [63].

Mean ARC size was determined by dynamic light scattering with a 90 Plus Particle size analyzer (Brookhaven Instruments) and Zeta potential was determined with a Zetasizer 4 (Malvern). Electron microscopy images of ARC upon phosphotungstic acid negative staining were obtained with a TEM Jeon 1210, 120 Kv, equipped with EDS analyzer LINK QX 2000.

Cytotoxicity

Upon incubation with ARC, cell viability was measured as mitochondrial dehydrogenase activity employing a tetrazolium salt (XTT) on Vero cells and the murine macrophage-like cell line J-774 [64].

Cells maintained at 37°C with 5% CO₂, in RPMI 1640 medium supplemented with 10% heat-inactivated FBS, 2 mM glutamine, 100 UI/ml penicillin and 100 μg/ml streptomycin, were seeded at a density of 5 × 10⁴ cells/well in 96-well flat bottom microplates. Culture medium of nearly confluent cell layers was replaced by 100 μl of medium containing 10, 100, 500 or 1000 μg/ml of lipids. Upon 24 h at 37°C, the cells were washed with 0.1 M phosphate buffered saline (PBS) pH 7.2, and incubated with 200 μg/ml of XTT for 4 h. XTT solution was removed and the extent of reduction of XTT to formazan within the cells was quantified by measuring the absorbance at 450 nm using an ELISA reader. Liposomes made of HSPC:cholesterol (1:1, mol:mol) were used as control.

Cell uptake

Cell uptake and intracellular fate of ARC loaded with the fluorophore/quencher pair HPTS/DPX was followed upon incubation with J-774 macrophages by fluorescence microscopy. ARC loaded with HPTS/DPX was prepared as stated before, except that the lipid films were hydrated with a solution of 35 mM HPTS and 50 mM DPX in Tris buffer. J-774 cells grown to near confluence on rounded coverslips in 24-well plate were incubated with 10 μg/ml μg of ARC-GC/BM-HPTS/DPX at 37°C for 10, 20, 30, 45 and 60 min. After incubation, suspensions were removed, cells were washed, and coverslips were mounted on a fluorescence microscope. Cell-associated HPTS fluorescence was monitored using a Nikon Alphaphot 2 YS2 instrument.

Similarly, the intracellular fate of both fluorescent ARC upon 45 min-incubation with J-774 cells was followed by monitoring the HPTS fluorescent signal along 1 h.

Immunization

Female 6-8-week-old C3H/HeN mice were obtained from University of Buenos Aires, Argentina, and maintained under standard conditions. The study was conducted following the Institutional Experimental Guidelines for Animal Studies. Groups of five animals were immunized subcutaneously (sc) on days 0 and 21 with 25 μg of BSA; 25 μg of BSA with added 100 μg of Al₂O₃ (BSA-Al, Alhydrogel^®, Superfos Biosector, Vedbaek, Denmark) or 25 μg of BSA entrapped in any type of ARC (ARC-GC-BSA or ARC-BM-BSA; 1.3 mg of archaeal lipids each ARC). Control mice were injected with equivalent amount of empty TEB. All groups were boosted with 25 μg of adjuvant-free BSA on day 180.

Evaluation of antibody response

Blood was collected from the tail vein at various time-points after immunization, as specified in the figure legends, and sera were analyzed by ELISA for the presence of anti-BSA antibodies. Briefly, microtiter plates (Nunc, Roskilde, Denmark) were coated overnight at 4°C with 45 μg/ml BSA diluted in 0.1 M carbonate-bicarbonate buffer (pH 9.6) and then blocked for 1 h at 37°C with PBS containing 0.2% Tween 20 (0.2% PBST) after washing with 0.05% PBST. Another wash as above described was followed by the addition of 100 μl of 3-fold dilutions of individual sera in 0.05% PBST. After 2 h at 37°C and further washing, the plates were incubated for 1 h at 37°C with horseradish peroxidase-conjugated goat anti-mouse IgG (Pierce, Rockford, IL) diluted 1:2000 in 0.025% PBST. For antibody isotyping, horseradish peroxidase-conjugated rat anti-mouse IgG1 or IgG2a revealing antisera (PharMingen, San Diego, CA), diluted 1:1000, were used. The plates were further washed and the reactions were developed by adding the ABTS substrate [2, 2'-azino-bis (3-ethylbenzthiazoline-6-sulphonic acid), Sigma Chemical Co., St. Louis, Mo]. Color was allowed to develop for approximately 10 min at room temperature in the dark. The optical density was measured at 405 nm using an ELISA reader (Multiskan Ex, Thermo Labsystems, Finland). Antibody titers are represented as end-point dilutions exhibiting an optical density of 0.3 units above background.

Statistical analysis

Statistical analyses were carried out with the Prisma 4.0 Software (GraphPad, San Diego, CA, USA). Group means were evaluated by ANOVA with Tukey's analysis to compare individual groups. Values of p < 0.05 were considered significant.