A microarray-based method for the parallel analysis of genotypes and expression profiles of wood-forming tissues in Eucalyptus grandis

RNA and cDNA quality

The RNA extracted from wood-forming tissue of the seven E. grandis trees was found to be of high quality and the absence of contaminating genomic DNA was confirmed for all cDNA samples (results not shown). The amplification of a region of the CAD2 genes from cDNA yielded the expected 410 bp mRNA-derived amplicon, which was clearly distinguishable from the 700 bp genomic DNA-derived, intron-containing fragments (results not shown).

Assembly of clones from cDNA library and cDNA-AFLP

cDNA libraries were constructed from RNA extracted from the seven E. grandis trees and a total of 810 cDNA clones were arrayed onto a microarray slide to be used for transcript profiling of the trees. The cDNA-AFLP clones were also generated from the seven trees and the selective amplification using the single +3 Mse/+2Pst primer combination showed high variable expression levels among the trees. Amplified fragments ranged in sizes from 100 bp to over 700 bp when visualized on polyacrylamide gels. These fragments were cloned and spotted onto the same microarray slide. In total 768 cDNA-AFLP clones were spotted to be used for the identification, fingerprinting and expression profiling of E. grandis trees.

Analysis of the combined array

The combined microarray containing a total of 1578 clones was hybridized with cDNA from the seven E. grandis trees. Hybridization profiles showed that 193 (12.6%) cDNA-AFLP clones and 206 (13.4%) cDNA library clones were differentially expressed. This revealed that both approaches generated a similar amount of differentially expressed clones suggesting that both techniques are equally useful for expression profiling.

General expression patterns of the combined array

A 1578-probe prototype cDNA microarray was constructed by arraying selective amplifications (Mse3/Pst4) of 768 cDNA-AFLP fragments and 810 cDNA library clones from seven individual Eucalyptus trees onto silanized glass slides. The cDNA profiles were clustered according to their expression patterns using Pearson's correlation in the Cluster program of Eisen et al [27] and are shown in Fig. 1A. Based on the clustering, ten different groups of co-expressed genes could be annotated (Fig. 1B). Clusters 3 and 4 contain genes that were up-regulated in the high lignin and the two high splitting trees. Most transcripts represented in these clusters are involved in cell wall biogenesis and include genes such as glucuronic acid decarboxylase 3 (UXS3), xyloglucan endotransglycosylate (XET) and caffeoyl-CoA 3-O-methyltransferase (CCoAOMT). Cluster 10 represents genes that were up-regulated in the high lignin and in the two high splitting trees. Most transcripts belonging to this cluster are associated with stress/defense. One transcript belonging to cluster 2, the putative zinc finger protein, was up-regulated in one low lignin and in the two low splitting trees. This gene is also part of the stress group. In general it was observed that stress-related genes were mostly up-regulated in the high lignin and high splitting trees. A similar pattern was also observed for the transcripts responsible for the higher lignin content which were up-regulated in both the high splitting trees and high lignin trees.

The majority of ESTs were up-regulated in the low splitting trees and seem to be involved in metabolism and transcription. A D-isomer specific 2-hydroxyacid dehydrogenase, which has oxidoreductase activity, a 26S ribosomal RNA, a putative glycyl tRNA synthetase and a splicing factor Prp8 were identified in these groups. Most of the transcripts belong to the functional category cell wall biogenesis and include transcripts such as glucuronic acid decarboxylase 3 (UXS3), xyloglucan endotransglycosylate (XET) and caffeoyl-CoA 3-O-methyltransferase (CCoAOMT). All three transcripts are known to play a fundamental role in regulating cell wall architecture and mechanical strength [30]. A second group of candidate transcripts that were up-regulated in the high lignin and high splitting trees were associated with stress/defense-related functions. This group contains transcripts such as a leucine-rich repeat, a lipase family protein and an antigen. Only a putative zinc finger protein in this group was up-regulated in one low lignin and in the two low splitting trees. All the transcripts associated with stress/defense are known to be strongly expressed in response to stress during secondary cell wall synthesis [31].

Quantitative expression analysis of cDNA-AFLP clones

Quantitative expression data for cDNA-AFLP clones was obtained by assaying the presence or absence of microarray markers using the hybridization patterns of the 768 E. grandis clones among trees. Generally, fragments on the array ranged in size from 100 bp to over 700 bp. Of 768 clones spotted onto the slide 133 (17.3%) were found to be polymorphic among the trees. The analysis was limited to only those spots for which clear threshold values (difference of 0.5 in relative intensity between two intensity classes) could be assigned. Spots with clear threshold values could be easily converted to binary scores (see Additional file 2). A unique microarray pattern was obtained for each Eucalyptus tree. Hybridisation profiles resulting from individual trees were 96% identical to those obtained in replicate, by reverse labelling reactions.

qRT-PCR verification

Plant materials and tissue harvesting

Differentiating xylem tissue samples were collected from each of seven 4-year old coppice re-growth E. grandis trees that belonged to two unrelated, open pollinated trials, called the 'Florida' and the 'Frankfort' trials. The 'Florida' trial was established from seed imported from Florida, USA and the 'Frankfort' trial was established from South African plantation trees. The E. grandis trees were originally planted in 1979 and felled in 1999. All trees were characterized for their splitting qualities and lignin content as described by Turner [47]. Seven trees that best corresponded to the two selected traits were used in this study and are shown in Additional file 3 along with the trait for which they were selected. Two low lignin and one high lignin tree were selected from the 'Florida' trial and two high splitting and two low splitting trees were selected from the 'Frankfort' trial. For total RNA extraction a section of the stem of the coppice was progressively debarked and the exposed xylogenic tissue was scrapped, immediately frozen and stored at -80°C.

Total RNA extraction, quality control and cDNA synthesis

Total RNA was isolated from xylem tissue of seven E. grandis trees (741-H (high lignin), 108-L (low lignin), 243-L (low lignin), 1/23/4-HS (high splitting), 1/71/6-HS (high splitting), 1/91/7-LS (low splitting) and 1/92/7-LS (low splitting)) as described by Chang et al. [48]. The total RNA was DNAse (Roche Diagnostics GmbH) treated and using an Oligotex^® mRNA Mini Kit (QIAGEN, Valencia, CA). RNA concentration was estimated using a ND-1000 Spectrophotometer (NanoDrop USA, Wilmington, DE) and integrity was evaluated on an agarose gel stained with ethidium bromide. Double-stranded cDNA was synthesized from purified RNA using the cDNA Synthesis System (Roche Diagnostics, Mannheim, Germany) according to manufacturer's protocol. cDNA was subsequently column-purified using the QIAquick PCR Purification Kit (QIAGEN). The purified cDNA were assayed for genomic DNA contamination by PCR using four separate intron-extron boundary spanning primer pairs: CCR.34-F1 (ACGTTGTGGTGGACGAGTC) and CCR.34-R1 (ACGTATGCCTGGACCGAGT) specific for the E. globulus cinnamoyl CoA reductase (CCR) gene; CCR1.23-F1 (CTTGTTGGAGCGACCTCGAA) and CCR1.23-R1 (ACGTACGCCTGGACCGAGTT) specific for the E. gunnii CCR1 gene; CAD.34-F1 (CTTGCAATTCGGACCAGGA) and CAD.34-R1 (GCTCCAATGCCTCCGTTCT) specific for E. saligna cinnamyl alcohol dehydrogenase gene; CAD.45-F1 (TCGCGATGCTTACCTAGTGAG) and CAD.45-R1 (CACGACGAACCTGTACCTGAC) specific for the E. gunnii cinnamyl alcohol dehydrogenase gene (CAD2) gene; these genes are known to be expressed in wood-forming tissues (Kirst et al. 2001). PCR amplification was performed using Taq DNA polymerase (Roche Diagnostics) at 55°C. Aliquots (5 μl) were removed after 20, 25, and 35 PCR cycles and assayed by agarose gel electrophoresis. cDNA synthesized was then used for cDNA-AFLP analysis and cDNA library construction.

cDNA-AFLP analysis and library construction

cDNA-AFLP analysis was performed on the seven individual trees as described by Vos et al. with minor modifications [49]. One hundred nanogram of double-stranded cDNA was used as initial template for restriction digestion with PstI and MseI (KeyGene). For pre-amplification an MseI primer and a PstI primer without a selective nucleotide were combined. The amplification mixtures obtained were diluted 20-fold and 5 μl were used for the selective amplifications. Twelve MseI primers with two or three selective nucleotides at the 3' end were combined with six PstI primers with two or three selective nucleotides at the 3' end were used for the cDNA-AFLP analysis. One primer combination (Mse3 and Pst4) was selected for further studies as it had the highest polymorphisms and large numbers of scorable bands. The adaptors and primers used for cDNA-AFLP analysis can be viewed in additional file 4. The cDNA-AFLP fragments obtained by selective amplification were inserted into a pGEM T-easy vector system II cloning kit (Promega, Madison Visconsin) following the manufacturer's instructions. Cloned cDNA-AFLP fragments were then amplified with primers T7 and SP6 (Promega, Madison Visconsin) for arraying onto the microarray slide.

cDNA library construction

The seven individual E. grandis trees were used to construct the cDNA library. The cDNA library was prepared by using the pGEM T-easy vector system II following the manufacture's instructions (Promega, Madison Visconsin). cDNA fragments were prepared by restriction-enzyme digestion of cDNA followed by ligation and transformation into Escherichia coli DH10α host cells. Individual colonies were plated on a grid followed by vector specific PCR using T7 and SP6 primers to verify that only single fragments were ligated. The cDNA library was stored at -80°C in 96 well microtiter plates in 75 μl of Luria Broth and 75 μl of a 50% glycerol solution. Before arraying, the individual clones were amplified using primers T7 and SP6 (Promega, Madison Visconsin) following the manufacturer's instructions (Promega, Madison Visconsin).

Construction of the combined cDNA array

The 1578 cDNA clones used for microarray construction were a combination of two separate libraries, namely 810 cDNA library clones and 768 cDNA-AFLP cloned fragments. Amplified cDNA and cDNA-AFLP clones were purified using Multiscreen^® PCR Purification Plates (Millipore, Molsheim, France) and visualized on a 1% agarose Electro-Fast^® Stretch gel (ABgene, Epsom, UK). Purified clones were robotically printed onto silanised glass slides (Amersham Biosciences, Little Chalfont, UK) using an Array Spotter Generation III (Molecular Dynamics, Sunnyvale, CA, USA). The GUS and bar genes and a fungal rDNA internal transcribed spacer (ITS) fragment were also printed to serve as controls for global normalization. Fragment were arrayed in duplicate on each slide at 250-μM. A fungal rDNA internal transcribed spacer (ITS) fragment, water and a bar gene at concentrations of 50 ng/μ, 100 ng/μl, 150 ng/μl and 200 ng/μl were also printed to serve as controls.

Hybridization of array slides

Seven E. grandis trees were used for microarray hybridizations. Probe cDNA from individual trees was prepared by restriction-enzyme digestion of cDNA (200 ng per tree) followed by ligation of restriction fragments to adapters and subsequent amplification following the protocol described above. Amplification products were column-purified using the QIAGEN PCR Purification Kit (QIAGEN, Valencia, CA) according to manufacturer's instructions. Probe cDNA labelling and hybridization were carried out following the procedure as described by Lezar et al. [50]. Reactions were spiked with cyanin-labeled controls for GUS, ITS and bar genes. Slides were scanned with a Genepix™ 4000B scanner (Axon Instruments, Foster City, CA, USA). The mean pixel intensity of each array that resulted from the individual hybridizations was quantified with the Array Vision 6.0 software (Imaging Research Inc., Molecular Dynamics, USA). For each hybridization experiment, one technical replicate (using independent labelling reactions) was performed, each replication consisting of a reverse labelling experiment. In addition, the whole experiment was repeated with one biological replicate labeled with Cy5 dye (i.e. three microarray slides were used in total for each sample).

Image acquisition, data processing and statistical analysis

For each spot on the array, local background signal intensities were subtracted and signal intensities of duplicate spots on glass slides were averaged. A clone was considered to have hybridized to the array, if its fluorescence was more than two standard deviations above local background. Abnormal spots (e.g. high background, dust, irregularities) were manually flagged for removal. Anomalous spots detected through manual inspection were removed, if the signal intensity of an array feature varied more than 10% from the duplicate spot. Signal intensities of duplicate spots were then averaged and spots with a signal-to-noise ratio of less than two were rejected. Intensity values were normalized across slides by global regression on the spot intensity data for tree 1/23/4-HS, which was used as a reference for normalization of all spot intensity data (reference design). The control genes GUS, ITS (200 ng/μl, 100 ng/μl and 50 ng/μl) and bar genes printed in duplicate on the array served as a separate control to confirm that data across slides was normalized correctly. The statistical significance of changes in transcript abundance was estimated using the methods described by Wolfinger et al. [51]. Only genes with an average fold-change of 1.4 for biological replicates and a p value of 0.01 were considered to be differentially expressed.

For the cDNA-AFLP fragments, normalized signal intensity values were used to identify polymorphic fragments based on their bimodal distribution of their intensity values across slides as described by Lezar et al. [50]. Polymorphic markers identified were then scored for the absence (0) or presence (1) of the fragment in each of the respective E. grandis trees. The absence and presence of polymorphic spots were used for cluster analysis of the pairwise genetic distances between the hybridization profiles of individual E. grandis trees, using Spearman correlation and hierarchical clustering (CLUSTER, available at http://rana.lbl.gov). The clustering results were visualized with TreeView [27]. Gene expression patterns were identified by converting normalized data into log₂ intensity values. Cluster analysis was performed on the normalized and mean-centered signal intensities using Pearson's correlation in the Cluster program and visualized in TreeView [27] in order to identify groups with similar expression patterns across the different E. grandis trees.

The data discussed above has been deposited at NCBI Gene Expression Omnibus (GEO) [52] and is accessible through GEO series accession number GSE14707.

Data quality

To assess the reproducibility of the methods used in this study, biological and technical replicates from pools of xylem RNA samples were hybridized onto the slides each carrying the clones in duplicate. Approximately 16 of the 1578 background-corrected spots, representing about 1.0% of the cDNA present on the glass slide had signal intensities that varied more than 10% of the mean of the two replicates and were manually removed from subsequent data analysis. Spots excluded from analysis showed inaccuracies in signal intensities. This can be ascribed to variability in the experimental process introducing inaccuracies in labelling, array hybridisation, signal detection and quantification. This approach allowed us to obtain correct and repeatable scores, reducing the occurrence of spots that varied sufficiently to be erroneously classified.

Sequencing and sequence analysis

Following microarray analysis, fragments of interest were re-amplified from the libraries using SP6 and T7 primers. Amplification products were column-purified using the QIAGEN PCR Purification Kit (QIAGEN, CA) according to manufacturer's instructions. Sequencing reactions were carried out at Inqaba (South Africa). Single-pass partial sequences were obtained with universal T7 primer. After manual removal of ambiguous sequences, sequences were assigned putative identities by translating BLAST (BLASTX) [53], against the non-redundant protein database of the National Centre for Biotechnological Information database [54]. E-values were considered significant if they were below 10^-3.

Confirmation of expression profiles by qRT-PCR

A subset of five genes was used to verify the microarray results. The five fragments that were chosen represent varying expression profiles across the E. grandis trees. Primer pairs were designed to UDP-glucuronic acid decarboxylase 3, hpt2 gene, D-isomer specific 2-hydroxyacid dehydrogenase, partial cDNA sequence of caffeoyl-CoA 3-O-methyltransferase (CCoAOMT) and protein-L-isoaspartate O-methyltransferase. Microarray analysis suggested that ribosomal RNA was expressed constitutively and was, therefore, used as a reference. The relative transcript abundance was detected by a Light Cycler (Roche Diagnostics, Basel, Switzerland) and Light Cycler FastStart DNA Master^PLUS SYBR Green I kit (Roche Diagnostics). PCR reactions were performed in a total volume of 20 μl containing 5 ng of single-stranded cDNA, 1 × Light Cycler FastStart DNA Master^PLUS SYBR Green I Master Mix and 1 μM of each primer. A negative control was run without cDNA template with every assay to assess the overall amplification specificity. Relative quantification was performed using the LightCycler software version 3.5.3 (Roche).