Efficient and specific knock-down of endogenous mERα in vitro: Transfection with pSUPER-shERα constructs

Three pSUPER-derived vectors [2] designed to drive expression shERα sequences were constructed. Two vectors contained sh sequences derived from the boundary of the DNA binding domain and the hinge region (shERα_1103), or from the ligand binding domain (shERα_1395) of mERα, respectively. A third expression vector contained both the shERα_1103 and shERα_1395 expression cassettes in series (shERα_tandem).

The efficiency of the shERα constructs for reducing endogenous ERα activity in vitro was determined using a luciferase reporter assay. For this purpose, the pSUPER-shERα_1395, pSUPER-shERα_1103, or pSUPER-shERα_tandem were transfected together with a reporter plasmid carrying a trimer of ERE plus TATA box upstream of luciferase (pERE-Luc) into endothelial cell lines (EOMA and H5V) and in mouse breast cancer cells (MXT). As shown in Figure 1A, upon transfection with shERα_1395, relative luciferase activity in lysates of all three cell lines was reduced by 70–80%. A similar result was obtained with shERα_1103 in EOMA's. In addition, the shERα_tandem expression construct proved to be more efficient than either of single shERα contructs alone in the EOMA cells, adding some 15% to the 70% reduction observed with shERα_1395 (Fig. 1A).

To evaluate the specificity of the shERα construct, shERα_1395 was introduced into EOMA cells over-expressing either mouse ERα or human ERα. The ERα_1395 target sequence contains only a single mismatch with the human ERα (Fig. 1B). Significant suppression of ERα mediated transcription was only observed in lysates of cells that were transfected with mouse ERα but not with human ERα (Fig. 1C). Thus, the observed effects of shERα_1395 are specific for mouse ERα. Moreover, changing a single nucleotide in shERα_1395 completely abolished the silencing effect (data not shown). By western blotting, the effect of shERα on ERα protein expression was studied (Fig. 1D). In the presence of shERα_1395, ERα protein levels were reduced to 33% as compared to control transfected cells. This reduction correlated well with our findings in the luciferase reporter assay. Thus, the observed inhibition of luciferase activity upon treatment with shERα_1395 or shERα_1103 is caused by reduced accumulation of mERα protein. All together, the shERα_1395 and shERα_1103 expression vectors are effective and specific in repression of murine ERα expression.

Knock-down of hepatic ERα expression in vivo: using Ad.shERα vectors

To repress ERα activity in vivo, Ad vectors expressing either shERα_1395 (Ad.shERα_1395), shERα_1103 (Ad.shERα_1103) or both (Ad.shERα_tandem) were generated (Fig. 2A). The H1 RNA promoter plus shERα expression cassettes were sub-cloned from the corresponding pSUPER into pAdTrack [5], which is engineered to co-express GFP enabling the tracking of infected cells. In addition, we constructed a control AdTrack plasmid, carrying only the H1 RNA promoter, which allowed for the generation of Ad.Empty. Prior to the evaluation of recombinant Ad vectors in vivo, we tested the functionality of the vectors in vitro. EOMA and MXT cells were transfected with pERE-luc, and subsequently infected with Ad.Empty or the Ad.shERα vectors. Fluorescence analysis indicated a near 100% infection percentage. The luciferase experiments (Fig. 2B) were comparable to those obtained with transfection of the pSUPER constructs (Fig. 1A): both Ad.shERα vectors repressed luciferase reporter activity up to 90%. Thus, Ad.shERα vectors were found to be fully functional with respect to repression of mERα activity.

We then proceeded with the application of our vectors in vivo. The Ad vectors (Ad.Empty, Ad.shERα_1395, or Ad.shERα_tandem) were injected in the tail vain of C57Bl/6 mice. This allowed examination of inhibition by shERα of endogenous hepatic mERα. Four days post-injection, animals were sacrificed, and the livers were studied for GFP expression and ERα mRNA level. Similar GFP expression patterns were observed in all groups, indicating equally efficient transduction (data not shown). ERα mRNA levels were studied by real time PCR analysis (Fig. 3). Administration of Ad.shERα_1395 reduced ERα mRNA levels 70%, whereas hepatic expression of shERα_tandem resulted in an 85% reduction.

Subsequently, we sought to examine the extent of shERα-mediated repression of hepatic mERα transcription activity. For this purpose, we constructed an Ad vector carrying the estrogen responsive luciferase reporter gene (Ad.ERE-Luc). First the estrogen-responsiveness of this vector was determined in vivo (Fig. 4A). Five days post-injection of 8 × 10⁸ pfu Ad.ERE-Luc, the mice were injected s.c with increasing concentrations of estrogen, ranging from 0 to 50 μg/kg. As shown in Fig 6, 6 hours post-injection, estrogen induced hepatic luciferase activity in a dose-dependent manner. Maximal stimulation was reached after applying 25 μg/kg estrogen. Then, we determined to what extend Ad.shERα down-regulates the transcriptional activity of hepatic ERα. Ad.shERα together with Ad.ERE-Luc reporter vector was administrated intravenously to C57BI/6 mice. Luciferase expression was detected by a CCD camera in living mice. Without estrogen treatment, all mice exhibited the same basal expression of the reporter construct (data not shown). Administration of 5 μg/kg estrogen, three and seven days after transduction with Ad.shERα_1103, resulted in a significant repression of hepatic ERα-mediated luciferase activity (Fig. 4B). These data were confirmed by measuring luciferase activity in liver extracts of mice that received estrogen (5 μg/kg, sc) five days post-injection with Ad.ERE-Luc plus Ad.Empty or Ad.shERα_1103 (Fig. 4C).

We conclude that Ad-mediated introduction of shERα in vivo results in an almost complete repression of hepatic mERα mRNA levels, as well as mERα-mediated transcription activity.

Plasmids

Two oligonucleotide pairs (mERα_1395: 5'-gatccccgctcctgtttgctcctaacttcaagagagttaggagcaaacaggagctttttggaaa-3' and 5'-agcttttccaaaaagctcctgtttgctcctaactctcttgaagttaggagcaaacaggagcggg-3', mERα_1103: 5'-gatccccgaatagccctgccttgtcc ttcaagagaggacaaggcagggctattc tttttggaaa-3' and 5'-agc ttttccaaaaagaatagccctgccttgtcctctcttgaaggacaaggcagggctattcggg) were ordered (Eurogentec, United kingdom). The bold nucleotides correspond to nucleotides 1395–1418 and 1103–1120 of the mRNA mERα sequence (GenBank accession number NM_ 007956). The underlined nucleotides represent a BglII and a HindIII site. These oligo's were annealed and ligated between the BglII and HindIII sites of pSUPER-H1prom [2]. The pSUPER-shERα sequences were verified by restriction and sequence analysis (ABI 3700, LGTC, Leiden).

The H1prom plus or minus shERα were cloned from the pSUPER into the promoter less pAdTrack vector [5] by use of XbaI and XhoI restriction sites. The Ad.shERα_tandem construct was generated by ligation of H1prom-shERα_1103 between the NotI and KpnI sites of pTrack-H1prom- shERα_1395.

The (ERE)₃TATA-Luc was cloned from pGl₃-basic as a ClaI-blunt/ KpnI fragment in EcoRV- and KpnI- digested promoter less Shuttle vector (pShuttle) (He et al. 2509–14). The functionality of this construct was verified by transfection. hERα was cloned from pCMV5 (pCMV5-hERα) [17] as a BamHI fragment in the BglII digested pShuttle-CMV vector. The pcDNA3.1-mERα expression vector was provided by Larry Jameson [18] and subcloned as a EcoRI-blunt fragment in the EcoRV digested pShuttle-CMV vector.

Cell culture

The MXT⁺ (murine breast cancer) cell line was generously provided by Dr. Bernards. H5V (a murine endothelial cell line derived from heart), EOMA (murine hemangioma-derived micro vascular cell line) and MXT cells were maintained in Dulbecco's modified Eagle's medium (DMEM) (Gibco BRL) supplemented with 10% fetal calf serum, 100 units/ml Penicillin, 100 μg/ml Streptomycin and glutamax (Invitrogen) (Complete DMEM). PERC6 cells [19] were maintained in complete DMEM supplemented with 10 mM MgCl²⁺. For large-scale production of recombinant Ad in PERC6 cells (Crucell, Leiden, he Netherlands), complete DMEM with 2% horse serum (Gibco) was used.

Luciferase reporter assays

Transient transfections were performed in triplicate in 12-wells plates (1.10⁵ cells per well) using Lipofectamine (Invitrogen). The effect of shERα on ERα mediated transcription regulation was determined by co-transfecting the cells with 100 ng of reporter construct (ERE)₃TATA-LUC and 500 ng expression vector pSUPER-shERα or an empty pSUPER control vector together with 100 ng pCMV-LacZ. After 24 hours, the cells were stimulated with complete DMEM containing 10^-9M Estrogen for an additional 24 hours. The cells were lysed with reporter lyses buffer (Promega) and after centrifugation of 2 min, supernatant was used for determining β-galactosidase normalized luciferase activity by adding 100 μl luciferyl-CoA (Promega) to 20 μl of cell extract in a monolight luminometer (BD Biosciences). β-galactosidase was measured in a 96-well microtiter plate using the β-Galactosidase Enzyme Assay System in reporter lyses buffer (Promega). Absorbance at 450 nm was determined in a microplate reader. Luciferase activities were normalized for transfection efficiency with the β-galactosidase activity and expressed as a percentage relative to expression levels induced by endogenous estrogen receptor (ER). Expression of endogenous ERα in those cells was verified by real time PCR.

Western blot analysis

Immunoblotting procedures were as described previously [20]. H5V cells seeded in triplicate in 12-wells plate were co-transfected with 20 ng pCMV-mERα and 500 ng expression vector pSUPER-shERα or an empty pSUPER control vector as described above. 28 hours post-transfection, the cells were lysed in 200 μl of RIPA buffer (1% NP40, 0.5% DOC, 0.1% SDS, 50 mM Tris pH 8.0, 150 mM NaCl, 2.5 mM EDTA) containing protease inhibitor (40 ul/ml, Roche). Extracts were cleared by centrifugation (4°C, 14 000 g, 5 min), and protein content was determined using the BCA kit (Pierce). Protein samples were denaturated (5 min, 90°C) and separated on SDS/PAGE by use of 8% gradient gels and were transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, Germany). Blots were stained with Ponceau S before blocking to verify equal loading and appropriate protein transfer. Membranes were blocked for 90 min in PBS, pH 7.4, containing 0.05% Tween 20 and 10% milk powder. Thereafter, membranes were incubated for 16 h at 4°C with ab MC20, 1:1000 (mERα rabbit polyclonal antibody, Santa Cruz Biotechnology, CA). After extensive washing with blocking buffer without milk powder or BSA, membranes were incubated for 2 h with horseradish peroxidase-conjugated goat anti-rabbit IgG, 1:5000 (Promega). Membranes were again extensively washed and bound peroxidase conjugates were visualized by enhanced chemiluminescence (ECL, Amersham) on a LumiImager workstation. Additionally, filters were stripped by a 30 min incubation in 100 mM β-mercaptoethanol, 2% SDS, 62.5 mM Tris-HCl pH 6.8 at 50°C, to proceed with the whole procedure as described above. However, now membranes were incubated for 16 h at 4°C with p-38 ab, 1:1000 (N-20, cs-728, rabbit polyclonal antibody, Santa Cruz Biotechnology, CA). Immunoblots were quantified using LUMIANALYST software on a LumiImager (Boehringer-Mannheim).

Adenoviral vectors

Recombinant adenoviral plasmids were generated by homologous recombination of pAdtrack or pShuttle vectors with pAdEasy1 in BJ5183 cells as described previously [5]. Correct clones were propagated in DH5α cells (Life Technologies). For the generation of the Ad.shERα vectors, Ad.Empty and Ad.ERE-Luc, PERC6 cells were transfected with 4 μg Pac-I-linearized adenoviral construct using LipofectAMINE PLUS (Life Technologies). After 16 hours transfection medium was replaced by growth medium. Transfected cells were harvested at day seven post-transfection and after three freeze-thaw cycles the lysate was used for large-scale production of Ad vectors in PERC6 cells. Virus was purified by double CsCl centrifugation and subsequently dialysed as described previously [21]. Final yields as assessed by plaque assays on 911 cells were approximately 2 × 10¹⁰ plaque forming units (pfu)/ml. The control virus (Ad.Empty) carries the green fluorescent protein (GFP) under control of cytomegalovirus promoter (CMV) and contained the H1prom. Ad.shERα_1395 and Ad.shERα_1103 carry GFP under control of CMV and shERα_1395 or shERα_1103 under control of H1prom. Ad. shERα_tandem carries both shERα_1395 and shERα_1103 under control of their own H1prom. Ad.ERE-Luc does not contain CMV-GFP and its functionality was verified in vitro and in vivo.

Infection cells

24 hours before transfection, 1.10⁵ cells per well were seeded into12 wells-plate. Cells were transiently transfected by use of lipofectamine with a total of 450 ng of DNA per well (150 ng of reporter plasmid (ERE)₃TATA-LUC and 300 ng pCMV-LacZ). After 4 hours cells were infected with either Ad.shERα or control Ad.Empty (MOI 5.000). Additionally, they received 10^-9M estrogen for 24 hours. Cells were lysed in 300 μl reporter lyses buffer. β-galactosidase and luciferase activity was determined as described above.

Animals and Ad Injection

The Ethics Committee for Animal Experiments of the Leiden University approved all animal work and the experimental protocols complied with the national guidelines for use of experimental animals. Male C57Bl/6JIco (Charles river, The Netherlands) were given a standard m diet Chow (Hope Farms, Woerden, NL) and housed under standard conditions in conventional cages with free access to water and food.

Recombinant Ad, with a maximum of 4 × 10⁹ pfu in 200 μl of PBS, were administered by injection into the tail vein of mice at the age of 14 weeks. Within five days post-infusion, mice were sacrificed; liver pieces were removed and immediately deep-frozen in liquid nitrogen and stored at -80°C.

Pharmacological treatment

The experiment was carried out in 12-wks old C57BL/6 male mice. To prevent sequestration of low doses of Ad.ERE-Luc by liver Kupffer cells, mice were pre-injected with Ad.LacZ (5 × 10⁸ pfu) 4 hours before administration of 8 × 10⁸ pfu Ad.ERE-Luc. 17β-estradiol (Sigma, E8875) was dissolved in sesame oil (Sigma). In the dose-response experiment, five days post-injection of Ad.ERE-Luc, 0, 5, 25 and 50 μg/kg 17β-estradiol was injected for 6 hours. Then liver pieces were rapidly dissected and immediately deep-frozen in liquid nitrogen and stored at -80°C for further analysis.

Bioluminescent reporter imaging

The experiment was carried out in 12 wks old C57BL/6 male mice co-injected with Ad.ERELuc (5 × 10⁸ pfu) plus either Ad.Empty or Ad.shERα (3 × 10⁹ pfu). Bioluminescent signals (BLS) were performed at time 0 and at several days after 6 and 24 hours s.c injections of 5 μg/kg 17 β-estradiol with the Xenogen IVIS imaging system (IVIS 100). The living mice were intraperitoneal (ip) injected with the luciferase substrate, luciferin, at a dose of 150 mg/kg body weight approximately 5 minutes before imaging. The mice were anaesthetized with isoflurane/oxygen and placed on the imaging stage. Total photon emission of each animal was acquired for 1 minute. Captured images were then quantified by using the Living Image software (Xenogen Corp, Almeda, CA) and the IGOR software (WaveMetrics Corp, Lake Oswego, OR). BLS from the region of interest (ROI) was expressed using the pseudo colour scale (Red most intense and Blue least intense luminescence) and the data were presented as the cumulative photon counts collected within each ROI. Because layers of tissue may limit photon emission from inner organs, the experiment was repeated. Of these mice the livers were rapidly dissected at day 5, 6 hours after 17β-estradiol administration, verifying the results from the bioluminescent reporter imaging by determining the luciferase activity in liver lysates

Luciferase enzymatic assay

The liver extracts were prepared by homogenisation with the minibead beater in reporter lyses buffer (Promega), two cycles of freeze-thawing and 2 min. of centrifugation at maximum speed. Supernatants were used for determining protein-normalized luciferase activity by adding 100 μl luciferyl-CoA (Promega) to 20 μl of liver extract in a monolight luminometer (BD Biosciences). Protein content was measured in a 96-well microtiter plate using the BCA protein assay kit (Pierce). Absorbance at 562 nm was determined in a microplate reader.

Real time quantitative PCR analysis

Total RNA was extracted from liver using TRIzol reagent (Life technologies). Purified RNA was treated with RQ1 RNase-free DNase (Promega, 1 units/2 μg of total RNA) and reverse transcribed with SuperScript II Reverse Transcriptase (Invitrogen) according to the manufacturer's protocol. Quantitative gene expression analysis was performed on an ABI prism7700 Sequence Detection System (Applied Biosystems) using SYBR Green as described earlier (Hoekstra et al. 25448–53). PCR primer sets (Cyclophilline, Fw: AAAAGGAAGACGACGGAGCC Rev: TCGGAGCGCAATATGAAGGT and mERα, Fw: CTAGCAGATAGGGAGCTGGTTCA, Rev: GGAGATTCAAGTCCCCAAAGC) were designed via Primer Express 1.7 software with the manufacturer's default settings (Applied Biosystems) and were validated for amplification efficiency. The absence of genomic DNA contamination in the RNA preparations was confirmed in a separate PCR reaction on total RNA samples that were not reverse transcribed. Cyclophilline was used as a control.

Data Analysis – The significance of differences in relative gene expression numbers C_t (C_t((Cyclo)-C_{t(target gene)}) measured by real time quantitative PCR was calculated using a two-tailed Student's t test. Probability values less than 0.05 were considered significant.