Skip to main content

Advertisement

  • Research article
  • Open Access

Overexpression of AtOxR gene improves abiotic stresses tolerance and vitamin C content in Arabidopsis thaliana

  • †1,
  • †1, 2,
  • 1,
  • 1,
  • 3 and
  • 1Email author
†Contributed equally
BMC Biotechnology201616:69

https://doi.org/10.1186/s12896-016-0299-0

©  The Author(s). 2016

  • Received: 1 March 2016
  • Accepted: 20 September 2016
  • Published:

Abstract

Background

Abiotic stresses are serious threats to plant growth, productivity and result in crop loss worldwide, reducing average yields of most major crops. Although abiotic stresses might elicit different plant responses, most induce the accumulation of reactive oxygen species (ROS) in plant cells leads to oxidative damage. L-ascorbic acid (AsA, vitamin C) is known as an antioxidant and H2O2-scavenger that defends plants against abiotic stresses. In addition, vitamin C is also an important component of human nutrition that has to be obtained from different foods. Therefore, increasing the vitamin C content is important for improving abiotic stresses tolerance and nutrition quality in crops production.

Results

Here, we show that the expression of AtOxR gene is response to multiple abiotic stresses (salt, osmotic, metal ion, and H2O2 treatment) in both the leaves and roots of Arabidopsis. AtOxR protein was localized to the Endoplasmic Reticulum (ER) in yeast and Arabidopsis cells by co-localization analysis with ER specific dye. AtOxR-overexpressing transgenic Arabidopsis plants enhance the tolerance to abiotic stresses. Overexpression of AtOxR gene resulted in AsA accumulation and decreased H2O2 content in transgenic plants.

Conclusions

In this study, our results show that AtOxR responds to multiple abiotic stresses. Overexpressing AtOxR improves tolerance to abiotic stresses and increase vitamin C content in Arabidopsis thaliana. AtOxR will be useful for the improvement of important crop plants through moleculer breeding.

Keywords

  • Abiotic stresses
  • L-ascorbic acid (AsA, Vitamin C)
  • Hydrogen peroxide (H2O2)
  • Transgenic plants

Background

In natural environments, plant growth and crop productivity are reduced by abiotic stresses such as high salinity, drought, heavy metals, and oxidative stress. Although these stresses might elicit different plant responses, most induce the accumulation of reactive oxygen species (ROS) [1, 2], including hydroxyl radicals (OH−), superoxide anions (O2 −), and hydrogen peroxide (H2O2). The production of large amounts of ROS in plant cells leads to oxidative damage [3–5]. In our previous study, we prepared a cDNA library from seedlings of a salt-tolerant plant, Puccinellia tenuiflora that had been treated with 150 mM NaHCO3 [6]. One of the sequenced genes, PutOxR, was found to confer enhanced tolerance to multiple abiotic stresses in yeast. Arabidopsis thaliana has a homologous gene, which in our preliminary studies was found to be associated with multiple abiotic and oxidative stress. We thus named it AtOxR (GenBank accession No: NP_568854), furthermore, the study of AtOxR gene have not been reported.

H2O2-scavenging in plants is achieved through several mechanisms, for example, the water–water cycle, catalase (CAT) enzymatic reactions, the glutathione peroxidase (GPX) cycle, and the ascorbate-glutathione (GSH) cycle [3]. These pathways involve a number of enzymes, such as superoxide dismutase (SOD), ascorbate peroxidase (APX), Catalase (CAT), and glutathione peroxidase (GPX) [7–9], and anti-oxidants such as glutathione [10, 11] and ascorbic acid (AsA) [10, 12]. In plants, H2O2 levels can be changed via the AsA/glutathione (GSH) cycle, APX plays a central role in the cycle and is emerging as a key enzyme in cellular H2O2 metabolism.

AsA is not only an important component of human nutrition but also an antioxidant and H2O2-scavenger that defends plants against abiotic stresses [13–16]. For example, enhanced AsA accumulation confers tolerance to oxidative, salt and drought stresses in potato and maintenance of a high AsA level is required for oxidative stress tolerance in Arabidopsis [17, 18]. AsA is synthesized through multiple biosynthetic pathways in plants [19–22], while the major pathway is Smirnoff–Wheeler pathway [22, 23]. Previous studies have shown that overexpression of AsA biosynthetic pathway related genes resulted in increased vitamin C content [24–30]. In addition, co-expression of NCED and ALO improves vitamin C content and tolerance to abiotic stresses in transgenic tobacco and stylo plants [31]. Although vitamin C is essential, humans are one of the few mammalian species unable to synthesis the vitamin and must obtain it through dietary sources. In recent years, the physiological function that AsA plays in abiotic stress tolerance and nutritional quality has garnered increasing attention.

In the present study, the expression pattern of AtOxR in seedlings treated by abiotic stresses was studied using quantitative real-time PCR (qRT-PCR). The subcellular localization of the AtOxR protein and the phenotypes of AtOxR gene transformants in yeast and Arabidopsis were also analyzed. Additionally, the H2O2 and vitamin C content of AtOxR transgenic Arabidopsis and WT plants were determined in plants grown under abiotic stresses.

Methods

Plasmid constructs and plant materials

The open reading frame (ORF) of AtOxR was amplified from Arabidopsis cDNA using the primers AtOxR-FW and AtOxR-RV (Table 1). The amplified product AtOxR was digested with KpnI and BamHI and cloned into the yeast expression vector pYES2 (Invitrogen) to form pYES2-AtOxR plasmid, which was transferred into Saccharomyces cerevisiae strain InVsc1. For the construction of GFP fusion proteins, AtOxR without its stop codon was amplified with the primers AtOxR-FW-BamHI and AtOxR-RV-KpnI (Table 1) by using AtOxR cDNA as a template, the amplified product was digested with BamHI and KpnI, and cloned into the pEGFP vector (Invitrogen). The construct plasmid pEGFP-AtOxR-GFP was digested with BamHI and EcoRI, and cloned into the pYES2 vector to obtain the plasmid pYES2-AtOxR-GFP, which was transferred into InVsc1 using a lithium acetate-based method [32]. AtOxR-GFP was amplified from pEGFP-AtOxR-GFP with primers AtOxR-FW-BamHI and GFP-RV-SacI (Table 1). The product was then digested with BamHI and SacI, and cloned into the pBI121 vector to obtain the plasmid pBI121-AtOxR-GFP. The constructs pBI121-AtOxR, pBI121-AtOxR-GFP and pBI121-GFP as control were transformed into Agrobacterium tumefaciens strain EHA105 to obtain the transgenic Arabidopsis by the floral dip method [33].
Table 1

Sequence of the primers used for PCR

Primer

Sequence (5’- 3’)

AtOxR-FW

ATGTATTTCGCCGCCATAGC

AtOxR-RV

TAAGCCTCTCTCCGTTTTCTCC

pBI121-AtOxR-FW

GGATCCTATGTATTTCGCCG (BamHI)

pBI121-AtOxR-RV

GAGCTCCTCCTCTAATAGTC (SacI)

AtOxR-FW-BamHI

GGTACCATGTATTTCGCCGCCATAGC (BamHI)

AtOxR-RV-KpnI

GGATCCGCCTCTCTCCGTTTTCTCC (KpnI)

GFP-RV-SacI

GAGCTCCTAGAGTCGCGGCCGC (SacI)

pYES2-AtOxR-FW

GGTACCTATGTATTTCGCCG (KpnI)

pYES2-AtOxR-RV

GGATCCCTCCTCTAATAGTC (BamHI)

AtOxR-RT-FW

TACGGAGGTTACGGATGGTC

AtOxR-RT-RV

GCCTCTCTCCGTTTTCTCCT

Actin-FW

GGTAACATTGTGCTCAGTGGTGG

Actin-RV

AACGACCTTAATCTTCATGCTGC

Phylogenetic analyses, yeast transformations, and growth conditions

Full-length amino acids sequences were aligned using ClustalX, and then imported into the Molecular Evolutionary Genetics Analysis (MEGA) package version 3.1 [34]. Phylogenetic analyses were conducted using the neighbor joining method in MEGA. The following accession numbers were used: AtOxR (GenBank accession number: NP_568854), Oryza sativa (NP_001058445), Glycine max (NP_001235783), Zea mays (ACG39093), Setaria italica (XP_004966149), Medicago truncatula (XP_003610078), Eutrema salsugineum (ESQ42667), Capsella rubella (EOA14055), Theobroma cacao (EOY31908), and Ricinus communis (XP_002532085).

Yeast transformations were performed using a lithium acetate-based method [32]. The empty vector plasmids pYES2-AtOxR and pYES2 were used as controls, and were introduced into the yeast strain InVSCI. The transformed yeast strains were grown in synthetic defined (SD) medium lacking the appropriate amino acids for the selective growth for the expression plasmids. For the response assays, yeast transformants were cultured in liquid yeast extract peptone dextrose (YPD) medium (1 % yeast extract, 2 % peptone, and 2 % glucose) until they reached an optical density at 600 nm of ≈ 0.6, and were then diluted 10−1-, 10−2-, 10−3-,10−4-, and 10−5-fold using double distilled H2O. Then, aliquots of each dilution were spotted onto solid yeast YPD and YPG medium (1 % yeast extract, 2 % peptone, and 2 % galactose) supplemented with different concentrations of NaCl (0.7 M, 0.9 M, 1 M), Mannitol (1 M, 1.2 M, 1.5 M), H2O2 (4 mM, 4.5 mM, 4.8 mM), MnCl2 (1 mM, 1.5 mM), MgCl2 (0.8 M, 1 M), CdCl2 (160 μM, 180 μM), BaCl2 (2 mM, 4 mM), CuCl2 (7 mM, 8 mM), FeCl3 (7 mM, 10 mM), AlCl3 (5.5 mM, 6 mM, 6.5 mM, 7 mM). A yeast transformant of the pYES2 empty vector was used as a control, and growth was monitored for 3–7 days at 30 °C.

Analysis of gene expression using quantitative real-time PCR

Arabidopsis seeds were surface sterilized and plated on solid half MS medium. After 2 days stratification at 4 °C, the plates were stored in a 22 °C incubator for propagation. The seedlings were transferred from the plates to a 1:1 mixture of soil and vermiculite and grown to maturity at 22 °C. The plants were cultured under a 16-h-light/8-h-dark cycle in a growth chamber. Roots, stems, leaves, panicle, and siliques of 2-month-old plants were sampled for qRT-PCR. A second batch of seedlings were pre-cultured for 2 weeks on 1/2 solid medium, and then treated with different concentrations of various stresses (150 mM NaCl, 300 mM mannitol, 50 μM CuCl2, or 3 mM H2O2), the shoots and roots were sampled after 0 h, 6 h, 12 h, and 24 h treatment and used for qRT-PCR analyses.

Total RNA was isolated using the RNeasy plant Mini kit (Qiagen, Hilden, Germany), and treated with RNase-free DNaseI (Qiagen, Hilden, Germany). First-strand cDNA was synthesized using SuperScript III reverse transcriptase (Invirogen, California, USA). Gene-specific primers pairs AtOxR-RT-FW and AtOxR-RT-RV were used for AtOxR, while Actin-FW and Actin-RV were used for Actin (Table 1). Relative quantification using qRT-PCR reactions were performed with SYBR green I using the LightCycler®480 system II (Agilent, USA).

Localization analysis of AtOxR protein in yeast and plant cells

Yeast transformants carrying the plasmids pYES2-AtOxR-GFP and pYES2-GFP were pre-cultured in liquid YPD medium overnight at 30 °C, washed three times with distilled water to remove the glucose and cultured in liquid SD uracil medium with galactose at 30 °C to induce the expression of GFP and AtOxR-GFP under the control of GAL promoter. Live cells were incubated with ER Tracker, and the localization of AtOxR-GFP was observed with a confocal microscope (Olympus Fluoview, FV500). Five-day-old transgenic roots carrying pBI121-GFP and pBI121-AtOxR-GFP were incubated with 1 μM Endoplasmic Reticulum (ER) Tracker for 15 min at 37 °C, and the localization of AtOxR-GFP was observed with a confocal microscope (Olympus Fluoview, FV500, Japan). GFP fluorescence was detected between 505 and 550 nm with excitation at 488 nm, ER Tracker dyes signals were detected using a 615 nm emission filter with excitation at 587 nm.

Analysis of the transgenic Arabidopsis plants

T3 homozygous transgenic plants overexpressing-AtOxR in a Col-0 backgrounds were selected with Kanamycin. Total RNAs of the individual lines were obtained using TRIzol. Denaturing gel electrophoresis was performed to examine the transformation of the AtOxR gene, which was identified using a probe labeled with digoxigenin (DIG, Roche, USA) followed by RNA gel blotting according to the methods described by [35]. Signals were detected using a luminescent image analyzer (Fujifilm, LAS-4000mini, Japan). The single lines were named #1, #2, #3, respectively. The seeds of transgenic plants were treated 10 days with different concentrations of NaCl (100 and 125 mM),mannitol (100 and 200 mM),CuCl2 (10 and 50 μM) and H2O2 (1 and 2 mM). T3 Seeds from the Arabidopsis Col-0 lines were surface-sterilized, grown on 1/2 MS plates, and supplemented with different concentrations of NaCl (100 and 125 mM) and H2O2 (1 and 2 mM) for 2 weeks. The seedling were grown under 16 h/8 h light/dark cycles at 22 °C, the root lengths were measured. Statistical analyses were performed using Student’s t-tests.

H2O2 content measurement

The H2O2 content was measured in 10-day-old WT and T3 generation transgenic plants that overexpress AtOxR and that had been treated with 150 mM NaCl, 300 mM mannitol, 50 μM CuCl2, and 3 mM H2O2 for 12 h, 24 h, or 48 h. Approximately 0.1 g fresh weight of each sample was harvested and immediately ground in liquid nitrogen with a mortar and pestle. The H2O2 content was measured colorimetrically at 415 nm by the titanium tetrachloride reaction method [36].

Measurement of total AsA content

To measure the AsA levels, seedlings of WT and T3 generation transgenic A.thaliana were grown on MS medium for 10 d, and that had been treated with 150 mM NaCl, 300 mM mannitol, 50 μM CuCl2, and 3 mM H2O2 for 12 h, 24 h, or 48 h. Approximately 0.1 g fresh weight of each sample was harvested and immediately ground in liquid nitrogen with a mortar and pestle. The AsA content was determined using an AsA content test kit (Comin, Soochow, China). Briefly, samples were ground under liquid nitrogen and homogenized in 1 mL of cold extraction buffer (solution I). The homogenate was centrifuged at 10000 rpm for 20 min at 4 °C, then the supernatant or standard solution (100 μl) were incubated with 800 μl solution II and 100 μl solution III, respectively, and pipetting immediately at room temperature. Then, the absorption values of 30 s and 150 s at 265 nm with UV spectrophotometer were used for calculated the total AsA levels of plants. Three biological replications were used for statistical analyses. Statistical significance was determined using Student’s t-tests.

Results

AtOxR, a single copy gene encoding an ER protein in Arabidopsis

A BLAST search of the NCBI database for matches to PutOxR identified one candidate (GenBank accession NO: NP_568854), which we named AtOxR. The sequence is from a gene of unknown function with 61 % identity to PutOxR at the amino acid sequence level. AtOxR is a single copy gene with a 564-bp open reading frame (ORF) encoding 188 amino acids with a predicted molecular mass of 20.19 kDa. Homologous proteins are found in several other plants (Fig. 1a). In a phylogenetic tree based on the amino acid sequences of the conserved region, AtOxR is most closely related to Eutrema salsugineum and Capsella rubella of the family Brassicaceae (Fig. 1b). AtOxR is predicted to have two transmembrane domains by the TMHMM algorithm (Fig. 1a, c).
Fig. 1
Fig. 1

Sequence and bioinformatic analyses of AtOxR. (a) Alignment of the amino acid sequence of AtOxR from Arabidopsis thaliana (GenBank No. NP_568854) with those of Oryza sativa (NP_001058445), Glycine max (NP_001235783), Zea mays (ACG39093), Setaria italica (XP_004966149), Medicago truncatula (XP_003610078), Eutrema salsugineum (ESQ42667), Capsella rubella (EOA14055), Theobroma cacao (EOY31908), and Ricinus communis (XP_002532085). b Phylogenetic trees based on the amino acid sequence of AtOxR and homologous sequences from the GenBank database. The accession numbers are listed in the Experimental Procedures section. (c) Transmembrane domains in AtOxR were predicted by the TMHMM algorithm (http://www.cbs.dtu.dk/services/TMHMM/), and are underlined in black in (a)

The ER was visualized using ER Tracker, an ER-specific dye for living cells. Because eukaryotic yeast shares similar cellular structures with plant cells, the subcellular localization of AtOxR in yeast and plant cells were both analysed with an ER Tracker in this study. We observed that the green fluorescence of GFP alone was almost evenly distributed throughout the yeast (Fig. 2A-a) and Arabidopsis root cells (Fig. 2B-a), whereas the green fluorescence of AtOxR-GFP fusion protein (Fig. 2A-c, B-c) and the red fluorescence of the ER Tracker (Fig. 2 A-e, B-e) overlapped (Fig. 2 A-d, B-d) in both yeast cells and Arabidopsis root cells (Fig. 2). These results suggested that the AtOxR-GFP was localized in the ER in yeast and Arabidopsis cells (Fig. 2), AtOxR is a single copy gene ecoding an ER protein in Arabidopsis genome.
Fig. 2
Fig. 2

Subcellular localization of AtOxR-GFP. A Expression of GFP protein (a, b) and AtOxR-GFP fusion constructs (c~f) in yeast cells. Scale bars = 5 μm. B Expression of GFP protein (a, b) and AtOxR-GFP fusion constructs (c~f) in A. thaliana root cells. The GFP column shows the signal detected in the green channel; the ER Tracker column shows the signal detected in the red channel; the GFP+ ER Tracker column corresponds to the merging of the green and red channels, in which yellow represents the superposition of green and red. DIC: differential interference contrast. Scale bars = 20 μm

Gene expression of AtOxR is induced by abiotic stresses in Arabidopsis

To examine the biological functions of AtOxR, we first investigated its expression pattern in various organs by qRT-PCR. This analysis showed that AtOxR was expressed in all Arabidopsis plant organs (root, stem, leaf, panicle, and siliques), with the highest levels of expression in leaves under normal conditions (Fig. 3a). When plants were grown in the presence of 150 mM NaCl, AtOxR mRNA expression, as shown by qRT-PCR, was induced within 6 h of treatment, declined at 12 h, and then increased again after 24 h in the leaves. In roots, AtOxR mRNA was slightly declined at 6 h after treatment, and then increased gradually and peaked at 24 h. In the presence of 300 mM mannitol, AtOxR mRNA expression peaked at 24 h in leaves, whereas expression was induced at 6 h after inititation of treatment in roots, and then began to decline gradually. After stressing with 50 μM CuCl2, AtOxR mRNA expression peaked at 24 h in both the leaves and roots. In the presence of 3 mM H2O2, AtOxR mRNA expression peaked at 24 h in both the leaves; in contrast, expression peaked at 6, and then declined in roots (Fig. 3b). Overall, these results suggest that the AtOxR gene confers a response to multiple abiotic stresses in both leves and roots of Arabidopsis.
Fig. 3
Fig. 3

Expression analysis of AtOxR gene from A. thaliana. (a) Quantitative RT-PCR analysis of AtOxR in different organs of A. thaliana. (b) Quantitative RT-PCR analysis of the expression of AtOxR in response to various abiotic stresses (see Methods for details). AtOxR expression was normalized against Actin mRNA levels; the reported data are the means of three replicate experiments ± S.E

Overexpression of AtOxR gene enhances tolerance to abiotic stresses in yeast and Arabidopsis

Growth of transgenic yeast cells carrying AtOxR was better on solid yeast YPG medium than that of control cells on media containing NaCl, mannitol, or H2O2 (Fig. 4a). The transformants also grew much better than did the empty vector transformants on media containing Al3+, Mg2+, Cu2+,Mn2+, Ba2+, or Fe3+ (Fig. 4b), suggesting that AtOxR is associated with the oxidative stress caused by high levels of cations.
Fig. 4
Fig. 4

Growth of AtOxR yeast transformants in response to a variety of abiotic stresses. Yeast transformants were grown on (a) YPD medium containing NaCl (0 mM, 0.7 mM, 0.9 mM, and 1 mM), mannitol (0 mM, 1 mM, 1.2 mM, and 1.5 mM), and H2O2 (0 mM, 4 mM, 4.5 mM, and 4.8 mM) in the presence of 2 % (w/v) galactose and (b) YPD medium containing different concentrations of the following metal ions: MgCl2 (0.8 mM and 1 mM), MnCl2 (1 mM and 1.5 mM), BaCl2 (8 mM and 10 mM), CdCl2 (160 μM and 180 μM), CuCl2 (7 mM and 8 mM), FeCl3 (7 mM and 10 mM), AlCl3 (5.5 mM, 6 mM, 6.5 mM, and 7 mM) in the presence of 2 % (w/v) galactose. Growth was monitored for 3–6 days at 30 °C

Three Arabidopsis transgenic plants that overexpressed AtOxR under the control of the CaMV35S promoter (#1–3) were identified by northern blotting (Fig. 5a). Control samples showed weak AtOxR signals, whereas the transgenic plants had higher expression confirming that the plants had been successfully transformed with AtOxR. In seedlings exposed to NaCl (100 and 125 mM), mannitol (100 and 200 mM), CuCl2 (10 and 50 μM), or H2O2 (1 and 2 mM), both the primary roots and leaves grew better in the AtOxR transgenic lines compared to WT plants (Fig. 5c–j), whereas the growth of WT was similar to that of the transgenic lines on control medium (Fig. 5b). Measurements confirmed that the root lengths (Fig. 5k–n) of AtOxR transgenic lines were higher than those of WT plants under stress conditions. These results suggest that overexpression of AtOxR improved the tolerance to multiple abiotic stresses in Arabidopsis.
Fig. 5
Fig. 5

Relative abiotic stress tolerance of wild-type (WT) and AtOxR-transgenic plants. (a) RNA gel blot analysis of T3 transgenic plants expressing AtOxR. WT: Arabidopsis thaliana ecotype Columbia-0; #1, #2, and #3: T3 seedlings with AtOxR on a Columbia-0 background. (b–j) Growth of WT plants and transgenic AtOxR plants (#1–3) on medium containing 1/2 MS (B), 100 and 125 mM NaCl (c–d), 100 and 200 mM Mannitol (e–f), 10 and 50 μM CuCl2 (g–h), and 1 and 2 mM H2O2 (i–j) for 14 days. (k–n) Root lengths of WT and AtOxR transgenic plants were measured after treatment. Each value represents the means ± SE of 15 plants. Statistical significance was determined using Student’s t-tests. *represents p < 0.05 and **represents p < 0.01

Determination of H2O2 and AsA content in AtOxR transgenic Arabidopsis plants under abiotic stresses

On the control medium, the H2O2 contents were slightly lower in three transgenic plants than those of WT plants, whereas H2O2 levels began to significant decrease in the three transgenic plants within 12 h of exposure to 150 mM NaCl, 300 mM mannitol, 50 μM CuCl2, or 3 mM H2O2, comparable to that of WT plants (Fig. 6). These results suggest that AtOxR is associated with H2O2 scavenging to lower oxidative stress.
Fig. 6
Fig. 6

Effect of abiotic stresses on H2O2 content in WT and transgenic plants. The H2O2 content of 10-day-old WT and T3 generation transgenic plants overexpressing AtOxR were assessed after 12, 24, or 48 h of treatment: (a) 150 mM NaCl; (b) 300 mM mannitol; (c) 50 μM CuCl2; (d) 3 mM H2O2. The means ± standard deviations (SDs) of three replicates are shown. Statistical significance was determined using Student’s t-tests. *represents p < 0.05 and **represents p < 0.01

In addition, we also test the AsA content in AtOxR transgenic plants under abiotic stresses conditions. Anylsis the phenotype of AsA levels in the normal condition (absence of stresses), the AsA content was higher in the transgenic plants than in the WT, while in the presence of stresses (150 mM NaCl, 300 mM mannitol, 50 μM CuCl2, and 3 mM H2O2), it was significantly higher after 12 h, 24 h, and 48 h treatment (Fig. 7a–d). To further confirm the content of AsA in WT and AtOxR transgenic plants under abiotic stresses conditions, HPLC method was used to determine the total AsA content in the tissues under 150 mM NaCl and 3 mM H2O2 conditions for 24 and 48 h treatment. The HPLC analysis showed similar trend to the results of test kit analysis (see Additional file 1). Overall, these results suggest that overexpression of AtOxR improves the accumulation of AsA content in transgenic plants compared with WT plants under abiotic stress conditions.
Fig. 7
Fig. 7

Effect of abiotic stresses on AsA content in WT and transgenic plants. AsA content of 10-day-old WT and T3 generation transgenic plants overexpressing AtOxR were assessed after 12 h, 24 h, or 48 h treatment: (a) 150 mM NaCl; (b) 300 mM mannitol; (c) 50 μM CuCl2; (d) 3 mM H2O2. The means ± SDs of three replicates are shown. Statistical significance was determined using Student’s t-tests. * represents p < 0.05 and ** represents p < 0.01

Discussion

AsA is known to play a role in response to oxidative stress, although the regulatory molecular mechanism of AsA synthesis has not been yet well understood. Here, we showed that AtOxR, an Arabidopsis gene of unknown function, is related to the levels of AsA and H2O2. AtOxR is predicted to have two transmembrane domains. AtOxR-GFP was localized to the ER in yeast and Arabidopsis cells (Fig. 2), the localization pattern of AtOxR-GFP is agreement with previous reports [37, 38]. Treatment with NaCl, mannitol, metal ions, or H2O2 induced AtOxR expression in both the leaves and roots (Fig. 3b). In plants, salt, osmotic stress, and metal ions can be indirect produce reactive oxygen species (ROS), which leads to oxidative stress [39–41]. Together, these findings suggest that the expression of AtOxR might be associated with oxidative stress. In addition, overexpression of AtOxR in yeast and Arabidopsis enhanced their tolerances to multiple abiotic stresses (Figs. 4 and 5). High levels of cations (such as Al3+, Cu2+, and Fe3+), salt, osmotic stress, etc. can be indirect produce ROS, which lead to oxidative stress [39, 41, 42]. Overexpressing AtOxR also improved the tolerance to metal ions in yeast and Arabidopsis (Figs. 4 and 5). Thus, these results suggest that the AtOxR gene has a role in the response to multiple abiotic stress, and associated with oxidative stress in yeast and plants.

Although moderate levels of ROS have a role in regulating various biological processes such as hormone signaling, and biotic and abiotic stress responses [1, 43], excessive ROS can cause irreversible damage in plants [3–5]. Our finding that AtOxR-overexpressing transgenic plants accumulated less H2O2 than did WT after challenge with NaCl, mannitol, CuCl2, and H2O2 (Fig. 6) is similarly to previous reports that the overexpression of stress resistance-related genes resulted in less H2O2 accumulation in response to abiotic stresses [14, 44–47].

Plants have four major H2O2-scavenging pathways. Two of these pathways, the water-water cycle and the ascorbate-glutathione cycle [3], are related to AsA, which is known to have roles in plant stress responses [48, 49]. Therefore, the effect of AtOxR on conferring tolerance to multiple stresses might be caused by the increased AsA content in AtOxR transgenic plants. In addition, AsA also has a role in ROS detoxification, as an antioxidant and H2O2-scavenger in plant cell to avoid accumulation of ROS under stress conditions [3, 50, 51]. In our study, the increased AsA content in AtOxR-expressing Arabidopsis in response to abiotic stresses (Fig. 7 and Additional file 1) suggests that AtOxR improves tolerance to abiotic stresses by increasing the AsA, which in turn promotes the scavenging of excess H2O2. Similar result was obtained in the transgenic plants expressing DHAR, GalDH and co-expression of NCED and ALO increased tolerance to abiotic stresses with elevated levels of AsA [28, 31, 52]. Therefore, our result suggest that overexpression of AtOxR is an effective way for use in crops improvement for increased tolerance to abiotic stresses and nutrition quality.

Conclusions

In this study, our results suggest that expression of AtOxR gene is response to abiotic stresses in roots and leaves of Arabidopsis. The H2O2 and AsA content of AtOxR-overexpressing transgenic plants were significantly lower and significantly higher, respectively, than those of WT plants under abiotic stress conditions, furthermore, overexpression of AtOxR gene improves abiotic stresses tolerance in Arabidopsis. In addition to this, because AsA is an important component of human nutrition, modified expression of AtOxR offers potential for the development of crop varieties with elevated AsA. Hence, increasing the AsA content in crops is important for further agriculture production through moleculer breeding.

Abbreviations

APX: 

Ascorbate peroxidase

AsA: 

L-ascorbic acid

CAT: 

Catalase

DIG: 

Digoxigenin

ER: 

Endoplasmic reticulum.

GPX: 

Glutathione peroxidase

GSH: 

Glutathione

H2O2 : 

Hydrogen peroxide

MS: 

Murashige and skoogmedium

O2 − : 

Superoxide anions

OH− : 

Hydroxyl radicals

qRT-PCR: 

Quantitative real-time PCR

ROS: 

Reactive oxygen species

SD: 

Synthetic defined medium

SOD: 

Superoxide dismutase

YPD: 

Yeast extract peptone dextrose medium

YPG: 

Yeast extract peptone galactose medium

Declarations

Acknowledgments

We thank Dr. Raymond for English editing.

Funding

This work was supported by China Postdoctoral Science Foundation (2016M590272), Heilongjiang Province Government Postdoctoral Science Foundation (LBH-Z15003) and Heilongjiang Province Foundation for Returnees (LC201405) awarded to Yuanyuan Bu. Further supported by the Program for Changjiang Scholars and Innovative Research Team in University (IRT13053) awarded to Shenkui Liu. The funding bodies were not involved in design of the studies; collection, analysis, nor interpretation of the data; nor writing of the manuscript.

Availability of data and materials

Amino acids sequences of AtOxR (GenBank accession number: NP_568854), Oryza sativa (NP_001058445), Glycine max (NP_001235783), Zea mays (ACG39093), Setaria italica (XP_004966149), Medicago truncatula (XP_003610078), Eutrema salsugineum (ESQ42667), Capsella rubella (EOA14055), Theobroma cacao (EOY31908), and Ricinus communis (XP_002532085) are available in the NCBI-GenBank database. The datasets supporting the conclusions of this article are included within the article and its Additional file 1.

Authors’ contributions

YB, BS and SL designed the study. YB and BS performed the experiments and drofted the manuscript. YB and BS analyzed the data. AZ and XZ provide the materials. SL and TT supervised the study and critically revised the manuscript. All authors read and approved the final manuscript.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

Not applicable.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Key Laboratory of Saline-Alkali Vegetation Ecology Restoration in Oil Field (SAVER), Ministry of Education, Alkali Soil Natural Environmental Science Center (ASNESC), Northeast Forestry University, Harbin, 150040, People’s Republic of China
(2)
Heilongjiang River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Rd 232 Hesong, Daoli District, Harbin, 150070, China
(3)
Asian Natural Environmental Science Center(ASNESC), The University of Tokyo, Nishitokyo Tokyo, 188-0002, Japan

References

  1. Apel K, Hirt H. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu Rev Plan Biol. 2004;55:373–99.View ArticleGoogle Scholar
  2. Sunkar R, Chinnusamy V, Zhu J, Zhu JK. Small RNAs as big players in plant abiotic stress responses and nutrient deprivation. Trends Plant Sci. 2007;12:301–9.View ArticleGoogle Scholar
  3. Mittler R. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 2002;7:405–10.View ArticleGoogle Scholar
  4. Hofer T, Badouard C, Bajak E, Ravanat JL, Mattsson A, et al. Hydrogen peroxide causes greater oxidation in cellular RNA than DNA. Biol Chem. 2005;386:333–7.View ArticleGoogle Scholar
  5. Møller IM, Jensen PE, Hansson A. Oxidative modifications to cellular components in plants. Annu Rev Plant Biol. 2007;58:459–81.View ArticleGoogle Scholar
  6. Liu H, Zhang XX, Takano T, Liu SK. Characterization of a PutCAX1 gene from Puccinellia tenuiflora that confers Ca2+ and Ba2+ tolerance in yeast. Biochem Biophys Res Commun. 2009;383:392–6.View ArticleGoogle Scholar
  7. Asada K, Takahashi M. Photoinhibition. In: Kyle DJ, Osmond CB, Arntzen CJ, editors. Production and scavenging of active oxygen in chloroplasts. Elsevier: Amsterdam; 1987. p. 227–87.Google Scholar
  8. Bowler C, Montagu MV, Montagu DD. Superoxide dismutases and stress tolerance. Annu Rev Plant Physiol Plant Mol Biol. 1992;43:83–116.View ArticleGoogle Scholar
  9. Willekens H, Chamnongpol S, Davey M, Schraudner M, Langebartels C, et al. Catalase is a sink for H2O2 and is indispensable for stress defence in C-3 plants. EMBO J. 1997;16:4806–16.View ArticleGoogle Scholar
  10. Noctor G, Foyer CH. Ascorbate and glutathione: keeping active oxygen under control. Annu Rev Plant Physiol Plant Mol Biol. 1998;49:249–79.View ArticleGoogle Scholar
  11. Creissen G, Firmin J, Fryer M, Kular B, Leyland N, Reynolds H, et al. Elevated glutathione biosynthetic capacity in the chloroplasts of transgenic tobacco plants paradoxically causes increased oxidative stress. Plant Cell. 1999;11:1277–92.View ArticleGoogle Scholar
  12. Conklin PL, Willlams EH, Robert RL. Environmental stress sensitivity of an ascorbic acid-deficient Arabidopsis mutant. Proc Natl Acad Sci. 1996;93:9970–4.View ArticleGoogle Scholar
  13. Smirnoff N. Ascorbic acid: metabolism and functions of a multi-facetted molecule. Curr Opin Plant Biol. 2000;3:229–35.View ArticleGoogle Scholar
  14. Li F, Wu QY, Sun YL, Wang LY, Yang XH, Meng QW. Overexpression of chloroplastic monodehydroascorbate reductase enhanced tolerance to temperature and methyl viologen-mediated oxidative stresses. Planta. 2010;139:421–34.Google Scholar
  15. Ma F, Wang L, Samma MK, Xie Y, Wang R, Wang J, et al. Interaction between HY1 and H2O2 in auxin-induced lateral root formation in Arabidopsis. Plant Mol Biol. 2014;85:49–61.View ArticleGoogle Scholar
  16. Karkonen A, Fry SC. Effect of ascorbate and its oxidation products on H2O2 production in cell-suspension cultures of Picea abies and in the absence of cells. J Exp Bot. 2006;57:1633–44.View ArticleGoogle Scholar
  17. Wang Z, Xiao Y, Chen W, Tang K, Zhang L. Increased vitamin C content accompanied by an enhanced recycling pathway confers oxidative stress tolerance in Arabidopsis. J Integr Plant Biol. 2010;52:400–9.View ArticleGoogle Scholar
  18. Yin L, Wang S, Eltayeb AE, Uddin MI, Yamamoto Y, Tsuji W, et al. Overexpression of dehydroascorbate reductase, but not monodehydroascorbate reductase, confers tolerance to aluminum stress in transgenic tobacco. Planta. 2010;231:609–21.View ArticleGoogle Scholar
  19. Loewus FA. Biosynthesis and metabolism of ascorbic acid in plants and of analogs of ascorbic acid in fungi. Phytochemistry. 1999;52:193–210.View ArticleGoogle Scholar
  20. Davey MW, Gilot C, Persiau G, Ostergaard J, Han Y, Bauw GC, et al. Ascorbate biosynthesis in Arabidopsis cell suspension culture. Plant Physiol. 1999;121:535–43.View ArticleGoogle Scholar
  21. Lorence A, Chevone BI, Mendes P, Nessler CL. Myo-inositol oxygenase offers a possible entry point into plant ascorbate biosynthesis. Plant Physiol. 2004;134:1200–5.View ArticleGoogle Scholar
  22. Wheeler GL, Jones MA, Smirnoff N. The biosynthetic pathway of vitamin C in higher plants. Nature. 1998;393:365–9.View ArticleGoogle Scholar
  23. Conklin PL, DePaolo D, Wintle B, Schatz C, Buckenmeyer G. Identification of Arabidopsis VTC3 as a putative and unique dual function protein kinase:protein phosphatase involved in the regulation of the ascorbic acid pool in plants. J Exp Bot. 2013;64:2793–804.View ArticleGoogle Scholar
  24. Agius F, Gonzalez-Lamothe R, Caballero JL, Munosz-Blanco J, Botell MA, Valpuesta V. Engineering increased vitamin C levels in plants by overexpression of a D-galacturonic acid reductase. Nat Biotechnol. 2003;21:177–81.View ArticleGoogle Scholar
  25. Bulley SM, Rassam M, Hoser D, Otto W, Schunemann N, Wright M, et al. Gene expression studies in kiwifruit and gene over-expression in Arabidopsis indicates that GDP-Lgalactose guanyltransferase is a major control point of vitamin C biosynthesis. J Exp Bot. 2009;60:765–78.View ArticleGoogle Scholar
  26. Bulley S, Wright M, Rommens C, Yan H, Rassam M, Lin-Wang K, et al. Enhancing ascorbate in fruits and tubers through over-expression of the Lgalactose pathway gene GDP-L-galactose phosphorylase. Plant Biotechnol J. 2011;10:390–7.View ArticleGoogle Scholar
  27. Liu W, An HM, Yang M. Overexpression of Rosa roxburghii Lgalactono-1,4-lactone dehydrogenase in tobacco plant enhances ascorbate accumulation and abiotic stress tolerance. Acta Physiol Plant. 2013;35:1617–24.View ArticleGoogle Scholar
  28. Tokuna T, Miyahara K, Tabata K, Esaka M. Generation and properties of ascorbic acid-over-producing transgenic tobacco cells expressing sense RNA for L-galactono-1,4-lactone dehydrogenase. Planta. 2005;220:854–63.View ArticleGoogle Scholar
  29. Naqvi S, Zhu C, Farre G, Ramessar K, Bassie L, Breitenbach J, et al. Transgenic multivitamin corn through biofortification of endosperm with three vitamins repre senting three distinct metabolic pathways. Proc Natl Acad Sci. 2009;106:7762–7.View ArticleGoogle Scholar
  30. Hemavathi, Upadhyaya CP, Akula N, Young KE, Chun SC, Kim DH, et al. Enhanced ascorbic acid accumulation in transgenic potato confers tolerance to various abiotic stresses. Biotechnol Lett. 2010;32:321–30.View ArticleGoogle Scholar
  31. Bao G, Zhuo C, Qian C, Xiao T, Guo Z, Lu S. Co-expression of NCED and ALO improves vitamin C level and tolerance to drought and chilling in transgenic tobacco and stylo plants. Plant Biotechnol J. 2016;1:206–14.View ArticleGoogle Scholar
  32. Gietz RD, Schiestl RH, Willems AR, Woods RA. Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast. 1995;11:355–60.View ArticleGoogle Scholar
  33. Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 1998;16:735–43.View ArticleGoogle Scholar
  34. Kumar S, Tamura K, Nei M. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence aligament. Brief Bioinform. 2004;5:150–63.View ArticleGoogle Scholar
  35. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. New York: Cold Spring Harbor Laboratory Press; 1989.Google Scholar
  36. Nag S, Saha K, Choudhun MA. A rapid and sensitive assay method for measuring amine oxidase based on hydrogen peroxide-titanium complex formation. Plant Sci. 2000;157:157–63.View ArticleGoogle Scholar
  37. Bu Y, Sun B, Zhou A, Zhang X, Lee I, Liu S. Identification and characterization of a PutAMT1;1 gene from Puccinellia tenuiflora. Plos One. 2013;8:e83111.View ArticleGoogle Scholar
  38. Seidel T, Schnitzer D, Golldack D, Sauer M, Dieitz KJ. Organelle-specific isoenzymes of plant V-ATPase as revealed by in vivo-FRET analysis. BMC Cell Biol. 2008;9:28.View ArticleGoogle Scholar
  39. Finkelstein RR, Gampala SS, Rock CD. Abscisic acid signaling in seeds and seedlings. Plant Cell. 2002;14:S15–45.Google Scholar
  40. Fedoroff NV. Cross-talk in abscisic acid signaling. Sci STKE. 2002;140:re10.Google Scholar
  41. Clemen S. Molecular mechanisms of plant metal tolerance and homeostasis. Planta. 2001;212:475–86.View ArticleGoogle Scholar
  42. Yamamoto Y, Kobayashi Y, Devi SR, Matsumoto H. Aluminum toxicity is associated with mltochondrial dysfunction and the production of reactive oxygen species in plant cells. Plant Physiol. 2002;128:63–72.View ArticleGoogle Scholar
  43. Kovtun Y, Chiu WL, Tena G, Sheen J. Functional analysis of oxidative stress-activated mitogen-activated protein kinase cascade in plants. Proc Natl Acad Sci. 2000;97:2940–5.View ArticleGoogle Scholar
  44. Wang J, Zhang H, Allen RD. Overexpression of an Arabidopsis peroxisomal ascorbate peroxidase gene in tobacco increases protection against oxidative stress. Plant Cell Physiol. 1999;40:725–32.View ArticleGoogle Scholar
  45. Hwang JE, Lim CJ, Chen H, Je J, Song C, Lim CO. Overexpression of Arabidopsis dehydration-responsive element-binding protein 2C confers tolerance tooxidative stress. Mol Cells. 2012;33:135–40.View ArticleGoogle Scholar
  46. Singh AK, Kumar R, Pareek A, Sopory SK, Singla-Pareek SL. Overexpression of rice CBS domain containing protein improves salinity, oxidative, and heavy metal tolerance in transgenic tobacco. Mol Biotechnol. 2012;52:205–16.View ArticleGoogle Scholar
  47. Wang F, Zang XS, Kabir MR, Liu KL, Liu ZS, Ni ZF, et al. A wheat lipid transfer protein 3 could enhance the basal thermotolerance and oxidative stress resistance of Arabidopsis. Gene. 2014;550:18–26.View ArticleGoogle Scholar
  48. Smirnoff N, Wheeler GL. Ascorbic acid in plants: biosynthesis and function. Crit Rev Biochem Mol Biol. 2000;35:291–314.View ArticleGoogle Scholar
  49. Zhang Z, Wang J, Zhang R, Huang R. The ethylene response factor AtERF98 enhances tolerance to salt through the transcriptional activation of ascorbic acid synthesis in Arabidopsis. Plant J. 2012;71:273–87.View ArticleGoogle Scholar
  50. Foyer CH, Noctor G. Redox regulation in photosynthetic organisms: signaling, acclimation, and practical implications. Antioxid Redox Signal. 2009;11:861–905.View ArticleGoogle Scholar
  51. Gill SS, Tuteja N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol Biochem. 2010;48:909–30.View ArticleGoogle Scholar
  52. Kwon SY, Choi SM, Ahn YO, Lee HS, Lee HB, Park YM, et al. Enhanced stress-tolerance of transgenic plants expressing a human dehydroascorbate reductase gene. J Plant Physiol. 2003;160:347–53.View ArticleGoogle Scholar

Copyright

© The Author(s). 2016

Advertisement

BMC Biotechnology

ISSN: 1472-6750

Contact us