Skip to main content

Table 1 Sequence of the primers used for PCR

From: Overexpression of AtOxR gene improves abiotic stresses tolerance and vitamin C content in Arabidopsis thaliana

Primer Sequence (5’- 3’)
AtOxR-FW ATGTATTTCGCCGCCATAGC
AtOxR-RV TAAGCCTCTCTCCGTTTTCTCC
pBI121-AtOxR-FW GGATCCTATGTATTTCGCCG (BamHI)
pBI121-AtOxR-RV GAGCTCCTCCTCTAATAGTC (SacI)
AtOxR-FW-BamHI GGTACCATGTATTTCGCCGCCATAGC (BamHI)
AtOxR-RV-KpnI GGATCCGCCTCTCTCCGTTTTCTCC (KpnI)
GFP-RV-SacI GAGCTCCTAGAGTCGCGGCCGC (SacI)
pYES2-AtOxR-FW GGTACCTATGTATTTCGCCG (KpnI)
pYES2-AtOxR-RV GGATCCCTCCTCTAATAGTC (BamHI)
AtOxR-RT-FW TACGGAGGTTACGGATGGTC
AtOxR-RT-RV GCCTCTCTCCGTTTTCTCCT
Actin-FW GGTAACATTGTGCTCAGTGGTGG
Actin-RV AACGACCTTAATCTTCATGCTGC