Skip to main content
Download PDF

Screening of Candida spp. in wastewater in Brazil during COVID-19 pandemic: workflow for monitoring fungal pathogens

BMC Biotechnology volume 24, Article number: 43 (2024) Cite this article

Abstract

Fungal diseases are often linked to poverty, which is associated with poor hygiene and sanitation conditions that have been severely worsened by the COVID-19 pandemic. Moreover, COVID-19 patients are treated with Dexamethasone, a corticosteroid that promotes an immunosuppressive profile, making patients more susceptible to opportunistic fungal infections, such as those caused by Candida species. In this study, we analyzed the prevalence of Candida yeasts in wastewater samples collected to track viral genetic material during the COVID-19 pandemic and identified the yeasts using polyphasic taxonomy. Furthermore, we investigated the production of biofilm and hydrolytic enzymes, which are known virulence factors. Our findings revealed that all Candida species could form biofilms and exhibited moderate hydrolytic enzyme activity. We also proposed a workflow for monitoring wastewater using Colony PCR instead of conventional PCR, as this technique is fast, cost-effective, and reliable. This approach enhances the accurate taxonomic identification of yeasts in environmental samples, contributing to environmental monitoring as part of the One Health approach, which preconizes the monitoring of possible emergent pathogenic microorganisms, including fungi.

Peer Review reports

Introduction

The rise in global temperatures due to greenhouse gas emissions enhances the pathogenic potential of fungi by allowing adaptation to higher temperatures, making them capable of surviving at mammalian body temperatures [1]. Fungal diseases, often linked to precarious hygiene and sanitation conditions, are exacerbated by pandemics. In December 2019, cases of severe respiratory distress of unknown cause emerged in Wuhan, China. The identified cause, SARS-CoV-2, quickly spread within China and beyond [2,3,4,5]. In January 2020, WHO declared the COVID-19 outbreak a Public Health Emergency of International Concern, particularly threatening countries with weak health systems [6]. By March 11, 2020, COVID-19 was declared a pandemic. Brazil confirmed its first case on February 26, 2020, in São Paulo, with Rio de Janeiro following a week later [7].

COVID-19 can cause severe respiratory issues and immunosuppression, marked by decreased TCD4+/TCD8 + cells and increased pro-inflammatory cytokines [8, 9]. ICU hospitalization for COVID-19, involving intubation, mechanical ventilation, and corticosteroid therapy, heightens the risk of invasive fungal infections (IFI) [9, 10]. The use of dexamethasone, a common COVID-19 treatment, further suppresses immune responses by affecting IL-2 synthesis, crucial for TCD4 + lymphocyte proliferation [11].

The One Health framework integrates the public health, veterinary, and environmental sectors. It is particularly relevant for Mycology since it concerns controlling zoonotic diseases, managing pollution, and combating antimicrobial resistance. In the context of the millions of species in the Fungi Kingdom, this approach discusses the positive and negative impact of these organisms on plants, human and animal health, and the role of the environment as an influencing factor in the emergence and re-emergence of fungi potentially pathogenic species [12]. Hyde [13], states that the Fungi Kingdom is the largest in terms of species diversity, with between 2.2 and 3.8 million estimated species, and of these, only 150,000 are described. The author highlights that fungi and species tracking, through different methods and strategies, are essential for the functioning of the ecosystem.

Among the species of fungi, yeasts, and mainly the genus Candida stand out, which includes around 150 species, some of them living in symbiosis in the microbiota of the reproductive and gastrointestinal mucosa of 50–70% of healthy individuals. These fungi have an opportunistic profile, causing infections in immunosuppressed hosts, mainly neutropenic patients, as well as in those undergoing treatment with broad-spectrum antimicrobials, parenteral nutrition, and invasive examinations. These conditions make Candida spp. important causative agents of candidiasis, which can be superficial or invasive [9, 14, 15].

Candida albicans-related infections represent around 80% of the more frequent infections caused by these species. However, non-albicans Candida species (Candida glabrata, Candida tropicalis, Candida krusei, Candida dubliniensis) are becoming more frequent [15]. Moreover, Candida auris has emerged as multi-drug resistant yeast, responsible for the major issues regarding patient treatment and surface disinfection in hospitals [16, 17].

In this sense, considering that climate change also favors the emergence of new virulent fungal lineages and long-distance spore dispersal, the prediction of where and when emergent fungal pathogens will appear, and establishing surveillance protocols such as the early detection of these pathogens, is essential. Diagnosing invasive candidiasis depends on culture methods and applied phenotypic and genotypic tools [9], which promote the accurate and early detection and identification of emergency fungal agents. Furthermore, preparing health system institutions and organizations to assist in choosing the best therapeutic regimen and diagnostic strategy, may define the outcome of the disease.

Based on these questions, the present study seeks to carry out a screening of yeasts and Sars-CoV-2 in wastewater, observing their biological diversity and pathogenicity profiles. Furthermore, we propose a workflow for quick and accurate identification of environmental samples, using polyphasic taxonomy.

Methods

Study area and sewage sampling

Sewage samples were monitored weekly and collected during the first wave of SARS-COV-2, in the municipality of Niteroi, state of Rio de Janeiro, Brazil (Fig. 1), according to Prado et al. [7]. 10 h-composite samples were stored in sterile polypropylene bottles and transported at 4 °C to the Laboratory of Comparative and Environmental Virology of the Oswaldo Cruz Foundation, where they have been pasteurized at 60 °C for 90 min to inactivate the coronaviruses. As described by Prado et al. [7], to detect the virus, briefly, 42 mL of sewage samples were centrifuged, and after supernatant discharge, the pellet was re-suspended in 4 mL of 0.25 N glycine buffer (pH 9.5), incubated, and mixed by vortex each 5 min. The solution was then neutralized and clarified by centrifugation. Supernatant samples were centrifuged, viral particles were re-suspended in PBS (pH 7.2) and processed immediately for nucleic acid extraction or stored at − 80 °C until use.

Fig. 1
figure 1

Location of Niterói on maps of Brazil and Rio de Janeiro State, indicating range of demographic density. B Sampling points distributed in Niterói municipality– location map (Reproduced from [7])

Full size image

Afterward, yeasts were isolated from the pre-established point of 45 mL of each sample and centrifuged at 4000 rpm for 5 min at the Laboratory of Taxonomy, Biochemistry and Bioprospecting of Fungi, Oswaldo Cruz Foundation. The supernatant was removed, and the pellet was resuspended in 250 µl of 0.9% saline solution.

Quantification of yeasts colony-forming unit (CFU)

Briefly, 20 µl of the solution described in heading 2.1 were deposited on two Petri dishes containing Sabouraud Dextrose Agar (SDA) medium (Difco, Becton-Dickinson and Company, USA), plus 400 mg/L of chloramphenicol and 25 mg/L of gentamicin and incubated at 35 °C for 5 days (Workflow in supplementary material 1). After, the colonies were quantified in UFC and each representative of them was transferred to test tubes containing SDA, for performed macroscopic description of the colony (adapted from [18]).

Phenotypic characterization

After the growth of the selected colonies in slant agar tubes containing SDA, at 35 °C for 24 h, 1 µL of the yeast suspension in 0.9% saline solution, equivalent to standard n° 1 of the McFarland scale was seeded in Petri dishes, containing the chromogenic medium CHROMagar® Candida (Difco, Becton-Dickinson and Company, USA). The plates were incubated at 37 °C for 48 h to assess their purity and the results were interpreted based on manufacturer’s guidelines, as follows: C. albicans - colonies light green to medium green, C. tropicalis - blue-gray, bluish-gray to blue-green or metallic blue colonies with or without violet halos in the middle, C. krusei - large flat colonies, light pink to light red with a whitish border, and nonspecific nuclei, other species. CHROMagar Candida Plus™ (CHROMagar, France) was used to evaluate the presence of C. auris species in the samples since light-blue colonies and a blue halo are described by the manufacturer as a suggestion of C. auris.

Additionally, to evaluate metabolic properties, sugar assimilation and enzymatic reactions were performed and analyzed by the VITEK 2 system (bioMerieux, France), using a YST card according to the manufacturer’s guidelines.

Molecular identification

MALDI-TOF MS

To identify the samples at the species level, MALDI-TOF MS was performed, according to Pinto et al. [19]. Briefly, yeast cells suspension at 106 were transferred from the culture plate to a tube containing 20 µl of 70% formic acid in water (v/v) and 1 µl of supernatant of each sample (in triplicate) was mixed with 10 µl of acetonitrile. Then, the sample was placed onto the MALDI-TOF MS stainless plate (Bruker Daltonics, Germany) and covered with 1 µl matrix solution α-cyano-4-hydroxycinnamic acid (CHCA, Fluka, Buchs, Switzerland). After drying, the spectra acquisition was done using the Bruker database to identify the isolate at the species level.

Colony PCR

Yeats were grown in SDA plates at 30 °C for 48 h. To perform colony PCR, a small portion of an isolated colony was picked using a micropipette tip and added to the PCR tubes as the DNA template. The cells were then heated in a microwave for 90 s and immediately placed on ice to prevent DNA degradation. Amplification was performed using 25ng of genomic DNA obtained in a 50-µl reaction volume, using 10 pmol of universal fungal primers ITS1 (CGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC), according to Lindsley et al. [20]. The annealing temperature of the reactions was 58 °C, carried out in a 96-well thermocycler (Applied Biosystems by Thermofisher Scientific).

To purify the amplicons was used QIAquick® PCR Purification Kit (QIAGEN®) according to the manufacturer’s protocol [19]. The sequences obtained in the Sequencing Platform at Fundação Oswaldo Cruz - PDTIS/FIOCRUZ, Brazil, were edited using the CodonCode Aligner software and compared by BLAST (Basic Local Alignment Search Tool) with sequences available from NCBI / GenBank. Neighbor-joining algorithm of Saitou and Nei [21], with 1000 replicate bootstraps, was used to perform the phylogenetic analysis.

Production of hydrolytic enzymes

To evaluate the production of hydrolytic enzymes followed the protocols of Rüchel et al. [22] and Price et al. [23], with modifications. Briefly, to determine aspartic protease activity, 1.17% yeast carbon base medium supplemented with 1% bovine serum albumin (BSA) was used. Phospholipase activity was determined using an egg yolk agar plate (Sabouraud dextrose agar supplemented with 1 M NaCl, 5 mM CaCl2, and 2% sterile egg yolk emulsion, pH 7.0). To evaluate the production of esterase, Tween agar plates were used (peptone, 10 g; NaCl, 5 g; CaCl2, 0.1 g; agar, 1.5%; Tween, 0.1%; pH 7.0 in 1000 mL of distilled water) according to Aktas et al. [24], with modifications. Finally, calcium phytate agar plates [glucose, 10 g; (NH4)2SO4, 0.5 g; KCl, 0.2 g; MgSO4.7H2O, 0.1 g; calcium phytate, 2 g; yeast extract, 0.5 g; MnSO4, 0.005 g; FeSO4, 0.005 g; agar, 15 g; pH 7.0 in 1000 mL of distilled water], to verify phytase activity [25].

After 48 h, 10 µL of fungal cell suspension were taken at a concentration of 1 × 107 cells/mL, stained on the surface of each agar medium, and incubated at 37 °C for up to 7 days. The production of hydrolytic enzymes was expressed as Pz (a/b) value, where (a) corresponds to the colony diameter and (b) colony diameter plus the hydrolysis/precipitation zone [23]. The Pz value was scored in four categories: (a) Pz 1.0: no production; (b) Pz 0.999–0.700: weak producers; (c) Pz 0.699–0.400: good producers; and (d) Pz less than 0.399: excellent producers [23].

Biofilm formation and biomass quantification

In 96-well plates, 200µL of the cell suspension in Sabouraud broth containing 106 cells was incubated at 37 °C for 48 without shaking. Then, the supernatant was removed, and the wells were washed 3-times with phosphate-buffered saline (PBS). To quantify the biomass, the biofilms were fixed with 200 µL of 99% methanol for 15 min and the supernatant was discarded. After drying the plates, 200 µL of 0.4% crystal violet solution (Sigma-Aldrich, St Louis, MO, USA) was added to each well and the plates were incubated at room temperature for 20 min. Then, the plates were washed to remove excess dye and the biomass was decolorized with 200 µL of 33% acetic acid for 5 min. One hundred microliters of this suspension were transferred to a new 96-well plate and the absorbance was measured at 590 nm using a SpectraMax M3 microplate reader (Molecular Devices, Sunnyvale, CA, USA) [26].

Results

Sample collection and viral detection

Twelve different samples were isolated in the points of collection (ESG03, ESG04, ESG07, ESG12, ESG13, ESG15, ESG17, ESG19, ESG20, ESG21, ESG22, and ESG23) and, in five of them, was possible to detect SARS-CoV-2 and quantify the viral load – VL (GC/100mL): ESG03 – VL 4.57; ESG13 – VL 4.59; ESG15 – VL 3.85; ESG17 – VL3.85 an ESG20 – VL3.67.

It was also observed in two samples collected from the same source (ESG19 and ESG20 from point 9), only one was positive for Sars-Cov-2 (ESG 20).

Fungal species identification

Macroscopic aspects of the colonies on SDA and CHROMagar Candida medium revealed that all isolates are different species belonging to Candida genera (Fig. 2A). In the chromogenic medium, the isolates showed color variation and the identification did not conclude at the species level in most samples. C. albicans was suggested as a species only in one isolate (ESG 19). Then, the biochemical analysis of carbohydrate assimilation was performed by the Vitek 2 system and, except for the ESG 3 and ESG 13 isolates that were classified as undetermined (when the system identifies more than two possible species), and one sample (ESG 19) unidentified, the most frequent species were C. parapsilosis and C. famata (Fig. 2B). However, when performing molecular analysis by MALDI-ToF and ITS sequencing, the most frequently identified species was C. palmioleophila (58.33%). The identification of the samples by the different methods is summarized in Table 1.

Fig. 2
figure 2

Candida species identification in Chromogenic medium ChromAgar Candida, after incubation at 37°C for 48 hours

Full size image
Table 1 Sample identification by biochemical analysis (VITEK 2 system) and molecular methods
Full size table

Hydrolytic enzyme and biofilm production

Regarding the production of Aspartic Protease and Calcium Phytate, five isolates (41,66%) were good producers and presented moderated activity with Pz values ranging from 0.67 to 0.51 and from 0.68 to 0.58, respectively. It was also observed that, except for two isolates (ESG 04 and PV 04), all the other samples were good Esterase producers (83,33% - Pz values 0.67–0.55). We highlight that ESG19 (C. albicans), ESG22 (C. tropicalis), and ESG23 (C. utilis) were the only isolates capable of producing three hydrolytic enzymes. On the other hand, none of the samples was able to produce Phospholipase (Table 2).

Table 2 Production of Hydrolytic enzymes by the isolates
Full size table

Figure 3 shows the mean absorbance values of the biomass produced by the samples, after 48 h of incubation at 37 °C, ranging from 0.152 to 1.077. The ESG 04 and ESG 13, identified as C. palmioleophila, followed by ESG22, identified as C. tropicalis, showed the highest absorbance values. On the other hand, samples ESG 017 and ESG 20, both also identified as C. palmioleophila, presented the lowest absorbance values.

Fig. 3
figure 3

Biofilm formation by the Candida species on polystyrene surface and detection of fungal biomass by crystal violet incorporation in methanol-fixed biofilms at 590 nm The results were expressed as: A absorbance (ABS) and B mean per fungal species

Full size image

Discussion

Herein, used for the first time the workflow that proposes a fast method for screening yeast species associated with the environmental samples of monitoring SARS-CoV-2 from wastewater samples obtained from different areas of Niterói municipality, state of Rio de Janeiro state, Brazil. According to the biosafety measures preconized by Wu et al. [27] and Prado et al. [7], the sewage samples containing viral particles are heat-inactivated, guaranteeing biosafety in the screening of fungal samples.

During the COVID-19 pandemic, several studies have shown that wastewater analysis is an important tool for monitoring the spread of SARS-CoV-2 in some regions [7, 28,29,30]. However, regarding the monitoring of fungal species, the reports of association of Candida species with sewage samples, especially regarding highly thermophilic species, are rare. We can cite the paper of Hautala et al. [31], previously to the pandemic, that relates the occurrence of C. krusei in two sewage samples, but the authors consider these samples an unlikely source of infection to the patients. The resistance of fungi to high temperatures is highlighted in the present work, not only because they have survived the use of high temperatures for the inactivation of viral particles, but mainly because this reflects the evolutionary adaptations of these microorganisms in response to climate change since physiological adaptations by fungal species to global warming have brought new fungal threats [32]. It concerns to significant challenges inherent to this group of organisms, which include their capacity for rapid evolution, the lack of vaccines, and, mainly, the increase in drug resistance [32].

In this work, 12 samples were collected, and from them, six Candida species were isolated. The most frequent species found was C. palmioleophila, a species associated with wild populations of Spheniscus magellanicus penguins [33], as a bioremediation agent for the degradation of artificial azo dyes, under saline conditions [34], and isolated from marine ecosystems, such as marshes and platform sediments continental [35]. Environmental interactions indicate a potentially pathogenic species, resistant to extreme temperatures and high osmotic levels, as observed by Lapeña et al. [36], who related thermotolerance of C. utilis induced by changes in light-dark cycles. This species, considered non-pathogenic, and largely used in the food industry, was cited by some authors as the causal agent of candidemia and in some cases, resistant to antifungal drugs [37,38,39,40].

It is important to mention that this resistance to inhospitable conditions is not exclusive to C. palmioleophila, but to other Candida species. Several authors have described the osmotic adaptive metabolism of Candida albicans complex [41,42,43,44]. C. tropicalis, a species related to candidemia in Pakistan, India, Thailand, and Algeria, and the second causal agent of candidemia in Brazil [45] is also described as an osmotolerant species [46]. Thus, we argue that the detection of Candida species in wastewater in Brazil is a future concern for public health conjectures since wastewater is profusely discharged, even without treatment, in different aquatic environmental waters, such as beaches and rivers.

As aforementioned, antifungal resistance constitutes a threat to public health, and one of the most effective measures to minimize it is the rapid and accurate identification of the etiological agent, thus avoiding the use of broad-spectrum antifungals or those whose action on a particular fungus is ineffective or non-existent.

In this sense, due to the presumptive nature of CHROMagar Candida medium, especially in the case of emerging species, also observed in Vitek-2 automated system since the scarcity of some species in our database, phenotypic identification presents limitations that can lead to mistaken identification. As an example, in Denmark, C. palmioleophila is frequently misidentified as other Candida species such as C. famata and C. guilliermondii by the approach of traditional methods [47,48,49]. In Italy, it was reported two cases of candidemia, due to C. palmioleophila, which was misidentified as C. albicans by using the Vitek2 system and CHROMagar Candida in the initial diagnosis [50, 51] compared phenotypical and molecular methods for Candida spp. identification and demonstrated that phenotypic methods were insufficient for correct identification. Additionally, most of the wrongly identified strains showed a resistant antifungal profile, such as C. haemulonii, C. ciferri, and C. rugosa, reinforcing the importance of correct identification. It is important to mention that our group published a study [52] using C. palmioleophila isolates that showed a characteristic MIC indicating resistance to fluconazole, corroborating the findings of the authors that point out that resistance to some azole derivatives among species of the Saccharomycotina subphylum, in which Candida species are inserted, is associated with multifactorial circumstances, such as indiscriminate exposure to azoles, patient profiles, geographic location of the species and genetic particularities [53, 54].

When comparing the species identification by the Vitek-2 system and molecular tools, it is possible to note a discrepancy in our results. While there was observed discordance of results between the morphological and biochemical analysis, the ITS sequencing and MALDI-ToF results converged 100% with each other. These results corroborate the findings of other authors, that reported biochemical identification as an inaccurate approach [49, 50]. It is also important to note that in our work, we reported the wrong identification of Candida tropicalis, Candida parapsilosis, and Kodamaea ohmeri by Vitek 2. This is important information for professionals who perform the mycological routine of yeast identification.

In this context, we propose a new identification protocol, using molecular tools (Fig. 4). To obtain the DNA, whose ITS region was sequenced, we used the Colony PCR technique instead of conventional PCR. Colony PCR is a powerful tool for quick and easy screening of colonies grown on selective media. It is a strategy to distinguish true positives from false positives, low cost and fast, as the DNA is obtained from colonies grown within 48 h, without the need to purchase commercial extraction kits or to prepare them in-house. In some cases, it is a superior alternative to the old strategy of growing small cultures of multiple colonies, which requires extracting DNA from each culture [55].

Fig. 4
figure 4

Workflow for yeasts identification by polyphasic taxonomy

Full size image

Concomitantly to molecular approaches, our group preconizes the use of mass spectrometry attached to a matrix-assisted laser desorption-ionization (MALDI-TOF), as a tool that has been exploited due to its capacity to identify fungal species belonging to different fungal genera [56,57,58]. This methodology allows accurate identification of the yeasts since several studies of characterization of multiple Candida complexes and Saccharomycotina fungi have been compiled [54, 59].

Pathogenic and opportunistic fungi possess an arsenal of virulence attributes that allow them to survive and cause infection in the hostile environment of the human body. These factors interfere with antigen presentation and skew the T-cell response toward a nonprotective Th2 phenotype [60]. The ability to produce different classes of hydrolytic enzymes and to form biofilm are well-known virulence factors involved in Candida sp. infections, including C. albicans and many non-albicans Candida species [61].

In the present work, C. palmioleophila, C. albicans, C. krusei, and C. utilis isolates produced moderated Aspartic Protease and Calcium Phytate activity. In addition, 83,33% (10/12) of the isolates were good producers of Esterase. However, none of the isolates were capable of Mroczyńska and Brillowska-Dąbrowska [62] also evaluated the production of hydrolytic enzyme isolates of C. palmioleophila and demonstrated that all of them (100%) produced aspartic protease activity, and, unlike us, two (66.7%) isolates produced phospholipase activity. Pandey et al. [63] evaluated the activities of extracellular hydrolytic enzymes from different Candida spp. and observed that C. krusei failed to produce the esterase enzyme, corroborating what we observed in this species. However, 54.16% of C. tropicalis were strong esterase producers, contrary to what we observed. Regarding phospholipase production, the authors describe C. krusei and C. tropicalis as strong producers, while in our study, these species were unable to produce this enzyme.

When evaluating biofilm formation, it was possible to observe that all isolates could form a biofilm, with two isolates of C. palmioleophila having the highest means of absorbance for the biomass produced. Our results corroborate what was observed by Mroczyńska and Brillowska-Dąbrowska [62] who reported the biofilm formation capability of the three C. palmioleophila isolates included in their study. The third largest mean of absorbance was presented by C. tropicalis, described as a greater biofilm producer in the Candida genus [64], whose mature biofilms are composed of a dense network of blastoconidia and a large amount of extracellular matrix composed of carbohydrates, proteins, phosphorus, uronic acid, and hexosamine [65]. This ability confers various advantages to the microorganisms, including resistance to external aggressors, such as host immune responses and antifungal agents [61].

To sum up, our study points out the impact of global changes and the COVID-19 pandemic on the increasing number of new emerging fungal pathogens that need careful identification, due to modifications in their virulence profiles, which increase the incidence, lethality, and morbidity of fungal diseases. In this sense, we propose a workflow for screening wastewater samples and the inclusion of a new methodology in the identification protocol, applying highly effective molecular tools to discriminate species, using colony PCR, a simple, fast, and inexpensive technique, instead of conventional PCR. We emphasize that the One Health approach applied in our study will enable the early detection of emerging pathogenic yeasts, enabling rapid and accurate diagnosis, necessary to assist in choosing the best therapeutic regimen for the patient, paying attention to antifungal resistance, and culminating in the implementation of strategies for predicting new outbreaks of Candida sp.

Availability of data and materials

Data is provided within the manuscript or supplementary information files.

References

  1. Casadevall A. Global Catastrophic threats from the Fungal Kingdom: Fungal Catastrophic threats. Curr Top Microbiol Immunol. 2019;424:21–32. https://doi.org/10.1007/82_2019_161 .

    Article  PubMed  Google Scholar 

  2. Sanders JM, Monogue ML, Jodlowski TZ, Cutrell JB. Pharmacologic Treatments for Coronavirus Disease 2019 (COVID-19): A Review. JAMA. 2020;323(18):1824-36. https://doi.org/10.1001/jama.2020.6019.

  3. Jamilloux Y, Henry T, Belot A, Viel S, Fauter M, El Jammal T et al. Should we stimulate or suppress immune responses in COVID-19? Cytokine and anti-cytokine interventions. Autoimmun Reviews. 2020;102567.

  4. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, et al. Clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. The Lancet. 2020;395(10223):497–506.

  5. Zhu N, Zhang D, Wang W, Li X, Yang B, Song J, et al. A Novel Coronavirus from Patients with Pneumonia in China, 2019. N Engl J Med. 2020;382(8):727–33. 

  6. World Health Organization. https://www.euro.who.int/en/health-topics/health-emergencies/coronavirus-covid-19/news/news/2020/3/who-announces-covid-19-outbreak-a-pandemic. Accessed 18 Jun 2020.

  7. Prado T, Fumian TM, Mannarino CF, Resende PC, Motta FC, Eppinghaus ALF, Chagas do Vale VH, Braz RMS, de Andrade JDSR, Maranhão AG, Miagostovich MP. (2021). Wastewater-based epidemiology as a useful tool to track SARS-CoV-2 and support public health policies at municipal level in Brazil. Water Res. 1;191:116810. https://doi.org/10.1016/j.watres.2021.116810.

  8. Regalla D, VanNatta M, Alam M, Malek AE. COVID-19-Associated Cryptococcus infection (CACI): a review of literature and clinical pearls. Infection. 2022;50(4):1007–12.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  9. Song G, Liang G, Liu W. Fungal Co-infections Associated with Global COVID-19 Pandemic: A Clinical and Diagnostic Perspective from China. Mycopathologia. 2020;185(4):599-606. https://doi.org/10.1007/s11046-020-00462-9.

  10. Gangneux JP, Bougnoux ME, Dannaoui E, Cornet M, Zahar JR. Invasive fungal diseases during COVID-19: we should be prepared. J Mycol Med. 2020;30(2):100971. https://doi.org/10.1016/j.mycmed.2020.100971 .

    Article  PubMed  PubMed Central  Google Scholar 

  11. de Sequeira DCM, Menezes RC, Oliveira MME, Antas PRZ, De Luca PM, de Oliveira-Ferreira J, Borba CM. Experimental Hyalohyphomycosis by Purpureocillium lilacinum: Outcome of the Infection in C57BL/6 Murine Models. Front Microbiol. 2017;8:1617. https://doi.org/10.3389/fmicb.2017.01617.

  12. Romanelli C, Cooper HD, de Souza DBF. The integration of biodiversity into One Health Rev Sci Technol. OIE. 2014;33:487–96.

  13. Hyde KD. The numbers of fungi. Fungal Divers. 2022;114:1. https://doi.org/10.1007/s13225-022-00507-y.

  14. Rocha WRV da, Nunes LE, Neves MLR, Ximenes ECP de A, Albuquerque MCP de A. Candida genus - Virulence factores, Epidemiology, Candidiasis and Resistance mechanisms. RSD. 2021;10(4):e43910414283.

  15. Ciurea CN, Kosovski IB, Mare AD, Toma F, Pintea-Simon IA, Man A. Candida and Candidiasis-Opportunism Versus Pathogenicity: A Review of the Virulence Traits. Microorganisms. 2020;8(6):857. Published 2020 Jun 6. https://doi.org/10.3390/microorganisms8060857.

  16. Chaabane F, Graf A, Jequier L, Coste AT. Review on Antifungal Resistance Mechanisms in the Emerging Pathogen Candida auris. Front Microbiol. 2019;10:2788. Published 2019 Nov 29. https://doi.org/10.3389/fmicb.2019.02788.

  17. de Melo CC, de Sousa BR, da Costa GL, Oliveira MME, de Lima-Neto RG. Colonized patients by Candida auris: Third and largest outbreak in Brazil and impact of biofilm formation. Front Cell Infect Microbiol. 2023;13:1033707. Published 2023 Jan 23. https://doi.org/10.3389/fcimb.2023.1033707.

  18. Lara da Costa G, Escórcio Ferreira I, Corrêa-Moreira D, Marinho A, Benedito de Almeida A, Antônio Pereira S, Moraes Borba C and Marques Evangelista Oliveira M (2022) Soil samples from sporotrichosis transmission belt area: Searching for fungal species and their antagonistic activity against Sporothrix brasiliensis. Front Cell Infect Microbiol. 12:1033969. https://doi.org/10.3389/fcimb.2022.1033969.

  19. Pinto TN, Kohn A, da Costa GL, Oliveira LMA, Pinto TCA, Oliveira MME. Candida guilliermondii as an agent of postpartum subacute mastitis in Rio de Janeiro, Brazil: Case report. Front Microbiol. 2022;13:964685. https://doi.org/10.3389/fmicb.2022.964685.

  20. Lindsley MD, Hurst SF, Iqbal NJ, Morrison CJ. Rapid identification of dimorphic and yeast-like fungal pathogens using specific DNA probes. J Clin Microbiol. 2001;39(10):3505-11. https://doi.org/10.1128/JCM.39.10.3505-3511.2001.

  21. Saitou N, Nei M. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4(4):406-25. https://doi.org/10.1093/oxfordjournals.molbev.a040454.

  22. Rüchel R, Tegeler R, Trost M. A Comparison Of Secretory Proteinases From Different Strains Of Candida Albicans. Sabouraudia. 1982;20:233-44. 

  23. Price MF, Wilkinson ID, Gentry LO. Plate method for detection of phospholipase activity in Candida albicans. Sabouraudia. 1982;20(1):7-14. https://doi.org/10.1080/00362178285380031.

  24. Aktas E, Yigit N, Ayyildiz A. Esterase Activity in Various Candida Species. J Int Med Res. 2002;30:322–24. 

  25. Tsang PW. Differential Phytate Utilization in Candida Species. Mycopathologia. 2011;172:473–79.

  26. Ramos LS, Mello TP, Branquinha MH, Santos ALS. Biofilm Formed by Candida haemulonii Species Complex: Structural Analysis and Extracellular Matrix Composition. J Fungi (Basel). 2020;6(2):46. https://doi.org/10.3390/jof6020046.

  27. Wu F, Zhang J, Xiao A, Gu X, Lee WL, Armas F, Kauffman K, Hanage W, Matus M, Ghaeli N, Endo N, Duvallet C, Poyet M, Moniz K, Washburne AD, Erickson TB, Chai PR, Thompson J, Alm EJ. 2020. SARS-CoV-2 titers in wastewater are higher than expected from clinically confirmed cases. mSystems. https://doi.org/10.1128/mSystems.00614-20. 

  28. Gonzalez R, Curtis K, Bivins A, Bibby K, Weir M, Yetka K, Gonzalez D. (2020). COVID-19 Surveillance in Southeastern Virginia Using Wastewater-Based Epidemiology. Water Res. 116296. https://doi.org/10.1016/j.watres.2020.11629.

  29. Medema G, Been F, Heijnen L, Petterson S. (2020). Implementation of environmental surveillance for SARS-CoV-2 virus to support public health decisions: opportunities and challenges. Curr Opin Environ Sci Health. https://doi.org/10.1016/j.coesh.2020.09.006.

  30. Randazzo W, Truchado P, Cuevas-Ferrando E, Simón P, Allende A, Sánchez G. SARS-CoV-2 RNA in wastewater anticipated COVID-19 occurrence in a low prevalence area. Water Res. 2020;181:115942. https://doi.org/10.1016/j.watres.2020.115942.

  31. Hautala T, Ikäheimo I, Husu H, et al. A cluster of Candida krusei infections in a haematological unit. BMC Infect Dis. 2007;7:97. Published 2007 Aug 22. https://doi.org/10.1186/1471-2334-7-97.

  32. Casadevall A, Kontoyiannis DP, Robert V. On the Emergence of Candida auris: Climate Change, Azoles, Swamps, and Birds. mBio. 2019;10(4):e01397-19. Published 2019 Jul 23. https://doi.org/10.1128/mBio.01397-19.

  33. Ewbank AC, Duarte-Benvenuto A, Zamana-Ramblas R, Navas-Suárez PE, Gattamorta MA, dos Santos-Costa PC, Sacristán C. Case report of respiratory aspergillosis and candidiasis in wild Magellanic penguins (Spheniscus magellanicus), Brazil. Braz J Microbiol. 2021;52(2):967–75. https://doi.org/10.1007/s42770-021-00438-x.

  34. Jafari N, Kasra-Kermanshahi R, Soudi MR. Screening, identification and optimization of a yeast strain, Candida palmioleophila JKS4, capable of azo dye decolorization. Iran J Microbiol. 2013;5(4):434-40.

  35. Prasanna Kumar S, Muraleedharan PM, Prasad TG, et al. Why is the Bay of Bengal less productive during summer monsoon compared to the Arabian Sea?. Geophys Res Lett. 2022;29(24):88–1–88–4. https://doi.org/10.1029/2002GL016013.

  36. Lapeña MA, Vicente-Soler J, Soto T, et al. Light-induced rhythmic changes in thermotolerance in stationary-phase cells of Candida utilis. Int Microbiol. 2006;9(1):61-64.

  37. Sreelekshmi TS , Ninan MM, Premanand A, Chacko A, Sahni RD, Michael JS. Candida utilis: a rare cause of septicemia in children. Access Microbiol. 2021;3(10):000281. Published 2021 Oct 11. https://doi.org/10.1099/acmi.0.000281.

  38. Shivadasan J, Raksha K, Urs P. Candida utilis causing neonatal Candidemia – A case report and literature review. Apollo Medicine. 2016;13. https://doi.org/10.1016/j.apme.2016.01.001.

  39. Treguier P, David M, Gargala G, Camus V, Stamatoullas A, et al. Cyberlindnera jadinii (teleomorph Candida utilis) candidaemia in a patient with aplastic anaemia: a case report. JMM Case Rep. 2018;5:e005160. 

  40. Scoppettuolo G, Donato C, De Carolis E, Vella A, Vaccaro L, et al. Candida utilis catheter-related bloodstream infection. Med Mycol Case Rep. 2014;6:70–72. 

  41. Enjalbert B, Rachini A, Vediyappan G, Pietrella D, Spaccapelo R, Vecchiarelli A, Brown AJ, d'Enfert C. A multifunctional, synthetic Gaussia princeps luciferase reporter for live imaging of Candida albicans infections. Infect Immun. 2009;77(11):4847–58. https://doi.org/10.1128/IAI.00223-09.

  42. Brown AJP, Brown GD, Netea MG, Gow NAR. Metabolism impacts upon Candida immunogenicity and pathogenicity at multiple levels. Trends in Microbiology. 2014;22(11):614–22. https://doi.org/10.1016/j.tim.2014.07.001.

  43. Reyna-Beltrán E, Iranzo M, Calderón-González KG, Mondragón-Flores R, Labra-Barrios M L, Mormeneo S, Luna-Arias JP. The Candida albicans ENO1gene encodes a transglutaminase involved in growth, cell division, morphogenesis, and osmotic protection. J Biol Chem. 2018;293(12):4304–23. https://doi.org/10.1074/jbc.m117.810440.

  44. Ene IV, Walker LA, Schiavone M, Lee KK, Martin-Yken H, Dague E, Gow NA, Munro CA, Brown AJ. Cell Wall Remodeling Enzymes Modulate Fungal Cell Wall Elasticity and Osmotic Stress Resistance. mBio. 2015;6(4):e00986. https://doi.org/10.1128/mBio.00986-15.

  45. Lima R, Ribeiro FC, Colombo AL and de Almeida JN Jr.The emerging threat antifungal-resistant Candida tropicalis in humans, animals, and environment. Front. Fungal Bio. 2022;3:957021. https://doi.org/10.3389/ffunb.2022.957021.

  46. Zuza-Alves DL, Silva-Rocha WP, Chaves GM. An Update on Candida tropicalis Based on Basic and Clinical Approaches. Front Microbiol. 2017;8:1927. https://doi.org/10.3389/fmicb.2017.01927.

  47. Pincus DH, Orenga S, Chatellier S. Yeast identification - past, present and future methods. Med Mycol. 2007;45:97-121.

  48. Arendrup MC, Bergmann OJ, Larsson L, Nielsen HV, Jarløv JO, Christensson B. Detection of candidaemia in patients with and without underlying haematological disease. Clin Microbiol Infect. 2010;16(7):855-62. https://doi.org/10.1111/j.1469-0691.2009.02931.

  49. Jensen RH, Arendrup MC. Candida palmioleophila: characterization of a previously overlooked pathogen and its unique susceptibility profile in comparison with five related species. J Clin Microbiol. 2011;49(2):549–56. https://doi.org/10.1128/JCM.02071-10.

  50. Casagrande Pierantoni D, Bernardo M, Mallardo E, Carannante N, Attanasio V, Corte L, Roscini L, Di Fiore L, Tascini C, Cardinali G. Candida palmioleophila isolation in Italy from two cases of systemic infection, after a CHROMagar and Vitek system mis-identification as C. albicans. New Microbiol. 2020;43(1):47-50.

  51. Cendejas-Bueno E, Gomez-Lopez A, Mellado E, Rodriguez-Tudela JL, Cuenca-Estrella M. Identification of pathogenic rare yeast species in clinical samples: comparison between phenotypical and molecular methods. J Clin Microbiol. 2010;48(5):1895-9. https://doi.org/10.1128/JCM.00336-10.

  52. Costa GLD, Negri M, Miranda RPR, Corrêa-Moreira D, Pinto TCA, Ramos LS, Ferreira DG, Salomão B, Fumian TM, Mannarino CF, Prado T, Miagostovich MP, Santos ALSD, Oliveira MME. Candida palmioleophila: A New Emerging Threat in Brazil? J Fungi (Basel). 2023;9(7):770. https://doi.org/10.3390/jof9070770.

  53. Pfaller MA, Diekema DJ. Epidemiology of Invasive Candidiasis: a Persistent Public Health Problem. Clin Microbiol Rev. 2007;20(1):133–63. https://doi.org/10.1128/cmr.00029-06.

  54. Stavrou AA, Lackner M, Lass-Flörl C, Boekhout T. The changing spectrum of Saccharomycotina yeasts causing candidemia: phylogeny mirrors antifungal susceptibility patterns for azole drugs and amphothericin B. FEMS Yeast Res. 2019;19(4):foz037. https://doi.org/10.1093/femsyr/foz037.

  55. Bergkessel M, Guthrie C. Colony PCR. Methods Enzymol. 2013;529:299-309. https://doi.org/10.1016/B978-0-12-418687-3.00025-2.

  56. Santos C, Lima N, Sampaio P, Pais C. Matrix-assisted laser desorption/ionization time-of-flight intact cell mass spectrometry (MALDI-TOF-ICMS) to detect emerging pathogenic Candida species. Diagn Microbial Infect Dis. 2011;71:304-08.

  57. Oliveira MME, Santos C, Sampaio P, Romeo O, Almeida-Paes R, Pais C, Zancopé-Oliveira RM. Development and optimization of a new MALDI-TOF protocol for identification of the Sporothrix species complex. Res Microbiol. 2015;166(2):102–110. https://doi.org/10.1016/j.resmic.2014.12.00.

  58. Valero C, Buitrago MJ, Gago S, Quiles-Melero I, García-Rodríguez J. A matrix-assisted laser desorption/ionization time of flight mass spectrometry reference database for the identification of Histoplasma capsulatum. Medical Mycology. 2017;56(3):307–14. https://doi.org/10.1093/mmy/myx047.

  59. Lima-Neto R, Santos C, Lima N, Sampaio P, Pais C, Neves RP. Application of MALDI-TOF MS for requalification of a Candida clinical isolates culture collection. Braz J Microbiol. 2014;45(2):515-522. Published 2014 Aug 29. https://doi.org/10.1590/s1517-83822014005000044.

  60. Corrêa-Moreira D, Castro R, da Costa GL, Lima-Neto RG, Oliveira MME. Cerebrospinal fluid: a target of some fungi and an overview. Mem Inst Oswaldo Cruz. 2023;118:e220251. Published 2023 Mar 20. https://doi.org/10.1590/0074-02760220251. 

  61. Santos ALS, Thaís P Mello, Ramos LS, Branquinha MH. Biofilm: A Robust and Efficient Barrier to Antifungal Chemotherapy. J Antimicro. 2015;1:e101. 

  62. Mroczyńska M, Brillowska-Dąbrowska A. Virulence of Clinical Candida Isolates. Pathogens. 2021;10(4):466. https://doi.org/10.3390/pathogens10040466.

  63. Pandey N, Gupta MK, Tilak R. Extracellular hydrolytic enzyme activities of the different Candida spp. isolated from the blood of the Intensive Care Unit-admitted patients. J Lab Physicians. 2018;10(4):392-96. https://doi.org/10.4103/JLP.JLP_81_18.

  64. Kumari A, Mankotia S, Chaubey B, Luthra M, Singh R. Role of biofilm morphology, matrix content and surface hydrophobicity in the biofilmforming capacity of various candida species. J Med Microbiol. 2018;67:889–892. https://doi.org/10.1099/jmm.0.000747.

  65. Al-Fattani MA, Douglas LJ. Biofilm matrix of candida albicans and candida tropicalis: chemical composition and role in drug resistance. J Med Microbiol. 2006;55:999–1008. https://doi.org/10.1099/jmm.0.46569-0.

Download references

Acknowledgements

We are grateful to Fiocruz and all State Funding Agencies for supporting this project.

Funding

The authors are supported by INOVA IOC (IOC-026-FIO-21 - DC-M fellowship), the National Council for Scientific and Technological Development – CNPq (BOB. fellowship 150984/2023-5, MMEO. Grant Proc. 307007/2022) and Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro (FAPERJ MMEO – Grant: JCNE E-26/201.433/2021).

Author information

Authors and Affiliations

  1. Laboratory of Taxonomy, Biochemistry and Bioprospecting of Fungi, Oswaldo Cruz Institute, Oswaldo Cruz Foundation, Rio de Janeiro, 21040-360, Brazil

    Danielly Corrêa-Moreira, Gisela Lara da Costa & Manoel Marques Evangelista Oliveira

  2. Federal University of Pernambuco, UFPE, Pernambuco, 50670901, Brazil

    Reginaldo Gonçalves de Lima Neto

  3. Medical Microbiology Department, Paulo de Goés Institute of Microbiology, Federal University of Rio de Janeiro, Rio de Janeiro, 21941-909, Brazil

    Tatiana Pinto

  4. Laboratory of Microbiology, Federal Hospital of Andaraí, Rio de Janeiro, 20541-173, Brazil

    Bruna Salomão

  5. Laboratory of Comparative and Environmental Virology, Oswaldo Cruz Institute, Oswaldo Cruz Foundation, Rio de Janeiro, 21040-360, Brazil

    Tulio Machado Fumian, Camille Ferreira Mannarino & Marize Pereira Miagostovich

  6. Laboratory of Respiratory, Exanthematic, Enteric viruses and Viral Emergencies, Oswaldo Cruz Institute, Oswaldo Cruz Foundation, Rio de Janeiro, 21040-360, Brazil

    Tatiana Prado

  7. Laboratory for Advanced Studies of Emerging and Resistant Microorganisms, General Microbiology Department, Institute of Microbiology Paulo de Góes, Federal University of Rio de Janeiro, Rio de Janeiro, 21941-909, Brazil

    Lívia de Souza Ramos & André Luis Souza dos Santos

Authors
  1. Danielly Corrêa-Moreira
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Gisela Lara da Costa
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Reginaldo Gonçalves de Lima Neto
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Tatiana Pinto
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Bruna Salomão
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Tulio Machado Fumian
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Camille Ferreira Mannarino
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Tatiana Prado
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Marize Pereira Miagostovich
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Lívia de Souza Ramos
    View author publications

    You can also search for this author in PubMed Google Scholar

  11. André Luis Souza dos Santos
    View author publications

    You can also search for this author in PubMed Google Scholar

  12. Manoel Marques Evangelista Oliveira
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

D.C-M. - Original draft preparation, writing review and editing, analysis of the data, preparation of the figuresM.M.E.O. - funding acquisition, project administration, conceptualizationG.C., M.N., L.d.S.R., D.F., B.S., C.M., T.P. - methodologyD.C.-M, R.M., T.P. (Tatiane Pinto), T.F., T.P. (Tatiana Prado), M.M., A.L.S. and M.O.; validationAll authors have read and agreed to the published version of the manuscript.

Corresponding authors

Correspondence to Danielly Corrêa-Moreira or Manoel Marques Evangelista Oliveira.

Ethics declarations

Ethics approval and consent to participate

Not Applicable.

Consent for publication

Not Applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Corrêa-Moreira, D., da Costa, G.L., de Lima Neto, R.G. et al. Screening of Candida spp. in wastewater in Brazil during COVID-19 pandemic: workflow for monitoring fungal pathogens. BMC Biotechnol 24, 43 (2024). https://doi.org/10.1186/s12896-024-00868-z

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12896-024-00868-z

Keywords

BMC Biotechnology

ISSN: 1472-6750

Contact us