Skip to main content
Download PDF

Exploring the microbial diversity and characterization of cellulase and hemicellulase genes in goat rumen: a metagenomic approach

BMC Biotechnology volume 23, Article number: 51 (2023) Cite this article

Abstract

Background

Goat rumen microbial communities are perceived as one of the most potential biochemical reservoirs of multi-functional enzymes, which are applicable to enhance wide array of bioprocesses such as the hydrolysis of cellulose and hemi-cellulose into fermentable sugar for biofuel and other value-added biochemical production. Even though, the limited understanding of rumen microbial genetic diversity and the absence of effective screening culture methods have impeded the full utilization of these potential enzymes. In this study, we applied culture independent metagenomics sequencing approach to isolate, and identify microbial communities in goat rumen, meanwhile, clone and functionally characterize novel cellulase and xylanase genes in goat rumen bacterial communities.

Results

Bacterial DNA samples were extracted from goat rumen fluid. Three genomic libraries were sequenced using Illumina HiSeq 2000 for paired-end 100-bp (PE100) and Illumina HiSeq 2500 for paired-end 125-bp (PE125). A total of 435gb raw reads were generated. Taxonomic analysis using Graphlan revealed that Fibrobacter, Prevotella, and Ruminococcus are the most abundant genera of bacteria in goat rumen. SPAdes assembly and prodigal annotation were performed. The contigs were also annotated using the DOE-JGI pipeline. In total, 117,502 CAZymes, comprising endoglucanases, exoglucanases, beta-glucosidases, xylosidases, and xylanases, were detected in all three samples. Two genes with predicted cellulolytic/xylanolytic activities were cloned and expressed in E. coli BL21(DE3). The endoglucanases and xylanase enzymatic activities of the recombinant proteins were confirmed using substrate plate assay and dinitrosalicylic acid (DNS) analysis. The 3D structures of endoglucanase A and endo-1,4-beta xylanase was predicted using the Swiss Model. Based on the 3D structure analysis, the two enzymes isolated from goat’s rumen metagenome are unique with only 56–59% similarities to those homologous proteins in protein data bank (PDB) meanwhile, the structures of the enzymes also displayed greater stability, and higher catalytic activity.

Conclusions

In summary, this study provided the database resources of bacterial metagenomes from goat’s rumen fluid, including gene sequences with annotated functions and methods for gene isolation and over-expression of cellulolytic enzymes; and a wealth of genes in the metabolic pathways affecting food and nutrition of ruminant animals.

Peer Review reports

Background

Over the past two decades, there has been an increased global interest in the development of sustainable bio-renewable primarily owing to the increase in greenhouse gas emission, climate change and ultimately to reduce the dependency on fossil fuels [1]. Cellulosic biomass without any doubt is emerging as a sustainable raw material for the bioeconomy. Lignocellulosic biomass comprises mainly of polysaccharide polymers, cellulose, hemi-cellulose, pectin, and lignin [2]. The incorporation of enzymatic synthesis into a wide array of eco-friendly bioprocesses such as the hydrolysis of cellulose/hemi-cellulose has become an illustrious tool in deriving well defined bioactive compounds and biodegradable industrial products. Yet, the potential exploitation of cellulosic biomass conversion into its oligo and monosaccharides is particularly hindered due to the limited understanding of the complex recalcitrant nature of cellulose, hemi-cellulose and lignin, distinct biochemical functions of the enzyme, enzymatic pathways, and the dearth of tailor-made suitable efficient enzymes [3, 4]. This led to the increased investigation of novel hydrolytic enzymes from unique and extreme ecological niches. Hence, it is of utmost significance to understand the phenomenon behind the unexploited ecologically sustainable microbial bioresource.

The various kinds of cellulolytic and xylanolytic enzymes are found in microbes, plants, snails, termites, beetles, insects dwelling in various extreme environmental niches. Microorganisms are the prime producers of cellulolytic and xylanolytic enzymes which makes them the most prominent players in biomass decomposition [5]. Chen et al. reported that microbial enzymes possess the remarkable capability to significantly expedite the otherwise highly protracted process of biodegrading cellulosic biomass [6]. Ruminant’s rumen houses dense and complex community of symbiotic microbes that work together to break down lignocellulose [7]. These rumen microbial communities are perceived as the most potential biochemical reservoir of inordinately diverse and multi-functional cellulolytic enzymes with peculiar functional adaptation to enhance green biotechnological processes [8]. Bacterial community dominates the ruminal environment and hence considered as the most efficient biomass degrading enzymes in the herbivore gut microbiome. Despite this fact, the infancy in understanding about the rumen microbial genetic diversity and a lack of suitable screening culture techniques has limited the exploitation of multiple promising enzymes. To date, less than 5% of the microorganisms on Earth are being cultivated using traditional laboratory techniques (i.e., great plate count anomaly) [9]. Owing to this documented disparity between cultivable and in situ diversity, a huge biodiversity of microbial community is inevitably misread. The recent advancement of metagenomics strategy has obtained great popularity for the culture free recovery of near complete microbial genomes from complex environmental niches.

With the development of metagenomics, meta-transcriptomic and metaproteomic, numerous studies of the gut microbiome of wood feeding insects, termites, ruminant animals (horses, cattle) have been reported with the discovery of diverse cellulolytic enzymes [10,11,12,13,14,15]. In 2011, Hess et.al reported that only 0.03% of the assembled rumen metagenome had hits to sequenced organisms [16]. Since then, thousands of bacterial metagenomes have been sequenced and deposited into public repositories. In 2018, Stewart et al. assembled 913 draft bacterial and archaeal Metagenome-Assembled Genomes (MAGs) from an extensive dataset of rumen metagenomic sequences obtained from 43 Scottish cattle [17]. In the work conducted by Seshadri et al., they introduced the Hungate1000 collection, which comprises 410 culturable archaeal and bacterial genomes. Remarkably, their analysis revealed that 336 of these organisms were detected in rumen metagenomic datasets [18]. In their comprehensive analysis, Li et al. uncovered 13,825,880 non-redundant bovine rumen prokaryotic genes, notably dominated by functional species specializing in the degradation of plant cell wall materials and methane production [19]. Variation in diet, morphology, physiology substrate availability and genetic makeup results diversity in the GIT (gastrointestinal tract) microbiomes. In a recent comparative metagenomics investigation of rumen ecosystems, conducted by Glendinning et al., a total of 391 MAGs were constructed across various ruminant species, including cows, buffaloes, sheep, and reindeer. This study unveiled substantial distinctions in ruminal microbiomes, as evidenced by variations in taxonomic composition and the presence of CAZymes genes [20]. In a separate investigation conducted by Han et al., the study delves into the influence of rumen degradable starch (RDS) levels on gut microbiota diversity and carbohydrate-active enzymes (CAZymes) in dairy goats. Their findings underscore that a high RDS diet is correlated with gastrointestinal health concerns, including inflammation, mucosal damage, and changes in gene expression [21]. Concurrently, investigations employing 16S rRNA analysis to investigate the phylogenetic diversity and community structure of African ruminants, yaks, deer, sheep, cattle, and reindeer have consistently revealed the significant influence of both diet and host genotype in shaping the composition and traits of the rumen microbiome [22,23,24,25]. Even so, metagenomic sequences from the rumen continue to yield novel and unique sequences that are distinct from those found in public databases [26]. Moreover, only limited works have reported the cloning of genes encoding glycosyl hydrolases inhabiting goat rumen bacterial metagenomes and their diversity and metabolic functions with respect to cellulosic biomass degradation. In this study, we encompass an analysis of goat rumen bacterial diversity exploiting a sequence driven metagenomic approach. Furthermore, the potential candidate genes encoding for cellulolytic and xylanolytic enzymes were further cloned and expressed to perform biochemical characterization of enzyme functionality.

Methods

Rumen sample collection and metagenomic DNA isolation

Rumen fluid was obtained from eight 1–2-year-old male meat goats when they were slaughtered at the goat farm at Langston University, Oklahoma. Goats were fed on a natural diet and hay [27]. (The rumen fluid was provided by Dr. Puchala at Langston University; no live animals were used in the study.) The rumen fluid was filtered through three layers of cheese cloth. Filtrates were used to extract genomic DNA following using the reagents for bacterial DNA extraction in FastDNA SPIN Kit (MP Biomedical, LLC, Solon, Ohio, USA) with modifications. Genomic DNA was purified further using the GeneClean Spin Kit (MP Biomedical). DNA concentrations were quantified with NanoDrop ND-1000 spectrophotometer (Thermo-Fisher, CA, USA). The quality of DNA (integrity) was confirmed by analysis on 1.0% agarose gel. The extracted genomic DNA was stored at -20 °C until further use.

Metagenomic DNA sequencing, assembly and annotation

For DNA sequencing, approximately 0.1 µg of the metagenomic DNA sample was used to construct the sequencing library using Nextera DNA Sample prep kits (Illumina, San Diego, CA). The resulting libraries had a range of fragments from approximately 200–400 bp and were quantified using a Qubit spectrofluorometer (Invitrogen, CA). Three libraries were prepared from goat rumen metagenomics DNA samples namely Bct_789, Bct_5121, and Bct_5122. The Bct_789 library was sequenced on an Illumina HiSeq 2000 using TruSeq SBS kit v3 for paired end 100 bp sequencing; the Bct_5121 and Bct_5122 libraries were sequenced on an Illumina Hiseq 2500 for paired end 125 bp sequencing respectively (Genomics Facility, Cornell University). The three libraries generated a total of 435 gb reads. The raw reads were deposited in the NCBI Sequence Read Archive (SRA) under accession number SRX2267715 for Bct_789, and SRX2267714 for Bct_5121, and Bct_5122.

The raw reads were processed using Cutadapt 4 program, which include trimming, filtering (-q 15,15 –trim-n -m 31 –pair-filter = any) and removal of adapter sequences (-b CAAGCAGAAGACGGCATACGAGATCTAGTACGGTCTCGTGGGCTCGG). The resultant high-quality reads were assembled using three kmer sizes (-k 35, 55, 75) in SPAdes [28, 29]. Annotation of the SPAdes assemblies was using the Prodigal gene prediction programs and Diamond searches against UniProt Bacterial sequences (only the top matching in each scaffold was listed) [30, 31]. Metaphlan and Graphlan were used to produce a phylogenetic classification across all three datasets [32]. All the computational analysis were completed by using pipeline from the Pittsburgh Blacklight Supercomputer (Pittsburgh Supercomputing Center, Pittsburgh, PA, https://www.psc.edu/).

Phylogenetic taxonomy and functional gene classification

The high-quality reads from Bct_789 were also subjected to Velvet (kmer size = 79) and SSPACE followed by CAP3 for assembly [33]. The assembled scaffolds were submitted to DOE-JGI for the Metagenome Annotation Pipeline (MAP v4) [34]. This annotation process encompasses the prediction of various elements, including CRISPR elements, non-coding and protein-coding genes. Briefly, the CRT and PILER-CR v1.06 tools were used for CRISPR element identification; a combination of Hidden Markov Models (HMMs) and ab initio gene calling algorithms was used for protein-coding genes and non-coding RNA genes identification; tRNAscan SE-1.3.1 was employed for tRNA prediction; hmmsearch tool from HMMER 3.1b2 was used for ribosomal RNA genes (5S, 16S, 23S) prediction; a consensus approach that combines the results of four ab initio gene prediction tools prokaryotic GeneMark.hmm (v. 2.8), MetaGeneAnnotator (v. Aug 2008), Prodigal (v. 2.6.2), and FragGeneScan (v. 1.16) was used for protein-coding gene prediction. Functional annotation is performed by associating protein-coding genes with Clusters of Orthologous Groups (COGs) employing RPS-BLAST 2.2.31. Based on the COG classification in DOE-JGI Integrated Microbial Genomes (IMG, https://img.jgi.doe.gov/), the annotated genes were classified into 26 COG functional categories. Putative endo-glucanase, exo-glucanase, and beta-glucosidase for cellulose degradation, endo-beta xylanase, beta-xylosidase for hemi-cellulose degradation were retrieved from carbohydrate transport and metabolism group of genes (279,864 gene count annotated).

Gene cloning with TOPO cloning system

The gene-specific primers for cellulase and hemi-cellulase genes were designed using OligoPerfect TM Designer (https://tools.lifetechnologies.com/content.cfm?pageid=9716, Table S1). In total, 14 cellulase and hemicellulase genes were cloned from the goat’s rumen metagenomic DNAs. PCR products were separated on 0.7% agarose gels. The DNA fragments of expected sizes were excised and purified from the gel using the QIAquick Gel Extraction Kit (Cat. No. 28704). The amplified genes were subsequently ligated to pET101 vector (Invitrogen, CA) and transformed into E. coli TOP10. Sanger sequencing was used to confirm the sequences of cloned gene. After the confirmation of 100% identity, these cloned sequences were submitted to the NCBI databank (http://www.ncbi.nlm.nih.gov).

Recombinant protein over-expression and characterization

The pET101 plasmids containing full-length open reading frames of the cloned genes were transformed into E.coli BL21 (DE3). The overnight BL21 culture was inoculated into LB with ampicillin and incubated for 2–3 h at 37 °C with agitation at 200 rpm until the culture's absorbance OD600 = 0.6–0.8. At this point, 0.6 mM IPTG was added to induce protein expression. Following a subsequent 5–6 h of post-induction at approximately 37 °C, the cells were harvested through centrifugation at 6,000X g for 5 min. To obtain crude protein, the cells were resuspended in a 100 mM HEPES buffer (pH 7.5) and subjected to sonication with three 30-s bursts separated by 1-min intervals, utilizing an amplitude of 65%. Crude protein samples were then mixed with 2X Laemmli Sample Buffer (BioRad) containing 5% β-mercaptoethanol. The protein samples were separated on a 10–20% sodium dodecyl sulfate polyacrylamide electrophoresis (SDS-PAGE) gel. The molecular weight (size) of the proteins was confirmed using Colloidal Blue Staining (Invitrogen).

To confirm the enzymatic activity of the recombinant proteins, fresh bacterial culture was directly inoculated into assay plates containing suitable substrates: carboxymethyl cellulose sodium salt (CMC) for endoglucanase and xylan for endo-1,4-beta xylanase. Then the plates were incubated at 37 °C for next 48 h. After incubation, the cellulolytic/xylanolytic activities were assayed using the Congo Red staining method [35, 36].

To quantify the enzymatic activity, freshly grown bacteria were lysed. And supernatant containing crude protein was tested for its ability to hydrolyze CMC, and xylan oat spelt, a substrate for the activity assay of endoglucanase A and endo-1,4-beta xylanase respectively. The reducing sugar released upon the hydrolysis of sugar polymers was determined using 3,5-dinitrosalicyclic acid (DNS) method [37]. The reducing sugar content was measured spectrophotometrically at 540 nm (Milton Roy Spectrophotometer, Model 601). One unit of enzymatic activity was defined as the amount of enzyme that liberates 1 μmol of reducing sugar from the substrate per minute under the above-mentioned assay conditions.

To determine the optimum pH, the recombinant crude enzyme was incubated at 50 °C for 45 min at pH 4.0–6.0 (sodium acetate buffer), pH7.0–8.0 (sodium phosphate buffer) and pH 9.0–10.0 (Tris–HCl buffer). The optimum temperature for endoglucanase A was determined by assessing enzyme activity in the range of 20–70 °C using CMC at 1% following a 45-min incubation at pH 6.0 (in a sodium acetate buffer). The same approach was employed for endo-1,4-beta xylanase, with the only adjustment being the pH set to 10.0 (in a Tris–HCl buffer). The pH stability was determined after keeping the enzymes at different pH at 50 °C for 24 h. The temperature stability was analyzed following the pre-incubation of endoglucanse A at pH-6.0 and endo-1,4-beta xylanase at pH-10.0 within a temperature range of 20–70 °C for 1 h respectively before further enzymatic activity test [38, 39].

Domain analysis and homology modeling of endoglucanase A and endo-1,4-beta xylanase

The analysis of protein domain architecture was performed using SMART program (http://smart.embl-heidelberg.de/). For phylogenetic analysis, 26 endoglucanase genes and 25 endo-1,4-beta xylanase genes were selected respectively from the NCBI, CAZY, UniProt and PDB databases [40], which cover a range of microorganism from bacteria, fungi, archaea, virus and unclassified organisms. The hit sequences were then aligned using neighbor-joining algorithm and P-distance model with the bootstrap simulation in MEGA X [41]. Furthermore, bootstrapping with resampling method of Felsenstein and 1000 bootstrap replicates was done in order to examine the robustness of the phylogenetic tree topology [42].

Multiple sequence alignments of the target proteins (endoglucanase A/ endo-1,4-beta xylanase) against their selected homology proteins were performed with the Clustal Omega software (https://www.ebi.ac.uk/Tools/msa/clustalo/). Furthermore, the sequence similarities and structural information from the aligned protein sequences were rendered through ESPript 3.0 analysis software package (http://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi).

The tertiary structures of endoglucanase A and endo-1,4-beta xylanase was predicted using homology modeling in Swiss Model (https://swissmodel.expasy.org/) [43]. In total, 50 different template structures available in protein data bank (PDB) were tested as template for the 3D model of endoglucanase A. The template used for the prediction of the 3D structure of the recombinant endoglucanase A is the available crystal structures of ligand bound PbGH5A (glycoside hydrolase; PDB ID: 5D9N) from Prevotella bryantii (PbGH), which shares about 44% amino acid sequence identity [44]. Similarly, the template used to generate the homology model of endo-1,4-beta xylanase is an available crystal structure of endo 1, 4 beta D-Xylanase 10B (Xyn10B) (PDB ID: 2WYS) from Clostridium thermocellum.

To validate the predicted 3D structure from SWISS-MODEL, Ramachandran plot was analyzed using RAMPAGE. The predicted structure was analyzed based on the global model quality estimation (GMQE) score. The accuracy of the predicted model of endoglucanase A with GMQE score of 0.71 was evaluated by Ramachandran plot using the RAMPAGE server (http://mordred.bioc.cam.ac.uk/~rapper/rampage.php) [45]. The information about the fitness and validation of the predicted recombinant protein model was further confirmed using the Verify3D (http://servicesn.mbi.ucla.edu/Verify3D/). Meanwhile, secondary structure of the predicted model of the enzyme was determined by using online available server STRIDE (http://webclu.bio.wzw.tum.de/cgi-bin/stride/stridecgi.py) [46]. The prediction of salt bridges (distances ≤ 3.2A) was performed using visual molecular dynamics (VMD, version 1.9.3) [47].

Results

Metagenomic DNA assembly, microbial taxonomy and Diamond annotation

As shown in Table 1, the raw reads generated are 456,435,541*2 for Bac_5122, 176,691,539*2 for Bct_5121, and 216,313,953*2 for Bct_789. In total, there were 1,698,882,066 raw reads generated from the sequencing libraries. The high-quality reads generated using Cutadapt include: 439,742,222*2 in Bct_5122 sample, 174,079,701*2 in Bct_5121 sample, and 205,548,701*2 in Bct_789 sample. Three different kmer sizes including 35, 55, and 75 were used in SPAdes assembly, and kmer = 75 results in the best assembly scaffolds. The total number of scaffolds in Bct_5122 was 9,329,048, in Bct_5121 was 5,253,641, in Bct_789 was 4,842,139. The largest scaffolds were around 200,000–220,000 bp, and the number of scaffolds with length over 20,000 were around 6,000 in all three samples.

Table 1 Goat rumen bacterial (Bct) metagenome sequencing assembly
Full size table

Metaphlan and Graphlan were used to perform phylogenetic classification across the three datasets generated from the three libraries (Fig. 1). Bacterial taxonomic profiling indicated that at phylum level, Firmicutes, Bacteroidetes, and Fibrobacteres were the dominant bacteria presenting in the goat rumen, which accounts for around 90% in total among others (Fig. 1a). In total, there were 18 bacterial orders and 1 archaeal order comprised with 40 species that were detected in goat rumen samples (Fig. 1b). At species level, Mathanobrevibacter_unclassified (2.75%, Archeae) was the major Archeae species; Butyrivibrio_unclassified (37.8%, Clostridiales), and Prevotella ruminicola (22.7%, Bacteroidales), Fibrobacter succinogenes (15.5%, Fibrobacterales), Butyrivibrio proteoclasticus (5.8%, Clostridiales), Desulfovibrio desulfuricans (5%, Desulfovibrionales), Bacteroides_unclassified (3.5%, Bacteroidales) Ruminococcus albus (2%, Clostridiales) were the predominant bacterial species present in goat’s rumen (Supplement Table S2). Some of these bacterial species were also identified as the chief producers of CAZymes in goat’s rumen ecosystem for cellulose degradation. Archaea Methanobacteria, which belong to methane producing ruminal Methanogens were also identified in the assembled sequences.

Fig. 1
figure 1

Goat rumen microbial community analysis using Metaphlan and Graphlan. a Approximately 96.6 -97.2% of fragments were assigned to bacteria, and 2.8–3.4% belonged to Archaea. The major phylum were Firmicutes (45–48.7%), Bacteroidetes (24.5–28.5%), and Fibrobacteres (14.1–16.5%). b The microorganisms annotated in all three datasets were combined. In total, 18 bacterial orders and 1 archaeal order comprised with 40 species were identified

Full size image

Diamond searching against UniProt Bacterial sequences was performed on all the three datasets (only the top matching in each scaffold was listed). There were 3,334,049, 5,437,719, and 7,901,185 genes identified in Bct_789, Bct_5121, and Bct_5122 distinctively. In all three samples, a total of 19,780 glucanase and 43,692 beta-glucosidase genes were detected, indicating the high abundance of enzymes involved in cellulose degradation. Similarly, 20,881 xylanase and 18,295 xylosidase genes were identified, indicating the high capability of goat rumen bacteria in hemicellulose/xylan degradation. Additionally, 1,123 pectin methylesterase, 7,779 pectate lyase, and 5,852 polygalacturonase genes were identified, suggesting the potential for pectin degradation (Table 2). Across all three datasets, a total of 3,327 bacterial strains were annotated with genes involved in the degradation of cellulosic biomass. Among these strains, a higher proportion were detected to possess cellulase genes, while a smaller number had genes involved in pectin degradation. Notably, a combined total of 327 bacterial strains were found to harbor functional genes for the degradation of plant fiber (comprised with cellulose, xylan, and pectin). The analysis revealed the presence of all seven enzymes (mentioned above) in eight bacterial species, namely Bacteroidals bacterium, Bacteroides sterorirosoris, Butyrivibrio proteoclasticus, Butyrivibrio sp INIIa14, Butyrivibrio sp Su6, and three species of Prevotella.

Table 2 Gene counts for genes in cellulose, hemicellulose and pectin degradation using Diamond annotation
Full size table

DOE_JGI annotation

The assembled scaffolds of Bct_789 were submitted to the Integrated Microbial Genomes (IMG) for annotation with the Img taxon object ID # 3300001425. There were 10,024,714 sequences subjected to annotation analysis. The annotation detected 748 CRISPR counts, 2,261 16 s rRNA, and 10,276,848 protein coding genes (accounts for 99.86% of annotated sequences), out of which, 3,054,241 of the genes belong to the Cluster of Orthologous Groups (COG, 30% of annotated sequences) and 2,236,087 genes were placed under the Pfam protein family domains (Table 3).

Table 3 Statistics of the assembled sequences annotation using DOE-JGI pipeline
Full size table

The 26 COG categories include general function prediction (11.62% of gene count), amino acid transport and metabolism (9.16% of gene count), carbohydrate transport and metabolism (8.3% of gene count), replication, recombination and repair (8.48% of gene count) and translation, ribosomal structure and biogenesis (8.18% of gene count), and cell wall/membrane/envelope biogenesis (6.98% of gene count). The total gene count for carbohydrate transport and metabolism was 279,864, which was the database to screen CAZymes for fiber digestion (Fig. 2, Table S3).

Fig. 2
figure 2

COG categories in DOE-JGI annotation

Full size image

In goat’s rumen, the degradation of plant fibers is performed under the action of microbial enzymes. For the cellulolytic genes, carbohydrate transport and metabolism GO category includes 347 endo-1,4-beta-D-glucanase genes (COG3405), 14 exo-beta-1,3-glucanase genes (COG5309), 1579 beta-glucosidase genes (COG2723) and 26 cellobiase genes (COG5297) for cellulose degradation; 3115 alpha-L-arabinofuranosidase genes (COG3534), 1753 endo-1,4-beta xylanase genes (COG3693), peptidoglycan/xylan/chitin deacetylase (COG0726) and 4475 beta-xylosidase genes (COG3664/3507) for hemicellulose degradation; and 876 pectin methylesterase genes (COG4677), 2894 polygalacturonase genes (COG5434), 478 pectate lyase genes (COG3866) for pectin degradation.

Out of 10,276,848 protein coding genes, 3,054,241 genes were identified with matching COG categories. Those COG categories for amino acid transport and metabolism; and carbohydrate transport and metabolism; and replication, recombination and repair were annotated with the highest number of gene counts.

Gene cloning and recombinant enzyme characterization

The five novel cellulase/xylanase genes namely endo-1,4-beta xylanase, endoglucanase A, beta-glucosidase A, endo-1,6 beta-D-glucanase, and endoglucanase E were cloned. These genes have been deposited in the NCBI GenBank databases under accessions KP851788, KP851789, KP851790, KP851791, and KP851792 respectively (Table S4). Two of the genes endo-1,4-beta xylanase and endoglucanase A were successfully transformed into E. coli BL21(DE3) and over-expressed with induction of IPTG. Proteins from cell lysates were separated on SDS-PAGE gel; the protein bands matched the expected molecular weight of the recombinant proteins, thus confirming the over-expression of the recombinant proteins in the bacterial clones (Fig. S1).

The activity of the recombinant enzymes was analyzed using the Congo red staining method. As shown in Fig. 3, the Congo red stained plates a and c (inoculated with recombinant bacterial colonies) exhibited a clear halo zone showing endoglucanase and endo-1,4-beta xylanase activities; on the two control plates (b, d) which were not inoculated with the bacterial inoculation, no substrate degradation was seen.

Fig. 3
figure 3

Plate enzymatic assay of endoglucanase A and endo-1,4-beta xylanase. a-d Plate assay determination of cellulolytic and xylanolytic activity by Congo red staining method; a and c were inoculated with BL21(DE3) harboring endoglucanase A and endo-1,4-beta xylanase respectively; b and d are negative control with inoculation of bacterial harboring empty vector

Full size image

The optimal enzyme activity of the crude recombinant endoglucanase A and endo-1,4-beta xylanase was analyzed at various pH and temperature. The optimum pH and temperature for endoglucanase A were pH 6.0 and 50 °C (Fig. 4a, b). The enzyme endoglucanase A displayed a higher thermostability which retaining above 50% of its activity at temperature 20–60 °C after 1-h incubation (Fig. 4b). However, its pH stability is relatively low, the enzyme activity at pH-4.0 and pH8.0–10.0 were severely decreased after incubation at 50 °C for 24 h (Fig. 4a). Within our testing range, the optimal enzymatic activity for endo-1,4-beta xylanase was observed at pH 10 and a temperature of 50 °C. However, it's worth noting that enzyme activity was not evaluated at pH levels greater than 10 (Fig. 4c, d). Similarly, the enzyme endo-1,4-beta xylanase retained over 50% activity at temperature ranging from 20–60 °C after 1-h incubation (Fig. 4d). Moreover, it retained about over 50% of its enzymatic activity at pH 5–10 after 24-h incubation at 50 °C (Fig. 4c).

Fig. 4
figure 4

Enzymatic activity and stability of endoglucanase A and endo-1,4-beta xylanase. The optimized activity and stability of the recombinant endoglucanase A and endo-1,4-beta Xylanase were determined at different temperatures and pH values. a Effects of pH on the endoglucanase A enzyme activity at 50 °C. b Effects of temperature on the endoglucanase A activity within a temperature range of 20–70 °C, at pH 6.0. c Effects of pH on the endo-1,4-beta xylanase enzyme activity at 50 °C. d Effects of temperature on the endo-1,4-beta xylanase activity within a temperature range of 20–70 °C, at pH 10.0

Full size image

Sequence and phylogenetic analysis of endoglucanase A and endo-1,4-beta xylanase

SMART protein sequence analysis stipulated that the putative enzyme endoglucanase A had a cellulase domain. A total of 26 endoglucanase protein sequences from the range of bacteria, fungi, Archaea, virus and unclassified organism were selected for the phylogenetic analysis. The phylogenetic analysis of endoglucanase A showed that it is closely related with the protein sequences from Prevotella ruminicola (WP074832387.1, Fig. 5a). Multiple alignments of the endoglucnase A with its homologous proteins in Prevotella ruminicola (WP074832387.1), Bacteroidales bacterium (HBA12588.1), Bacteroides xylanisolvens (WP117683893.1), Ruminococcaceae bacterium (A0A1G4QNM4) and Prevotella bryantii (PDB: 5d9M) indicated that the inferred amino acid sequence of a GH 5 family domain and the active site of the conserved domain (in green rectangle) with predicted catalytic residue (arrow pointed) in endoglucanase A were aligned with those of the homologous enzymes (Fig. 5b). Moreover, the protein shared less than 55.87% amino acid sequence identity with glycoside hydrolase family 5 protein from Prevotella ruminicola and 51.26% from Alloprevotella sp.

Fig. 5
figure 5

Phylogenetic and multiple alignment analysis of endoglucanase A and endo-1,4-beta xylanase. a, c Neighbor-joining phylogenetic tree of endoglucanase A and endo-1,4-beta xylanase based on protein sequences from various organisms. Scale bar corresponds to a genetic distance of 0.10 substitution/site. b, d Multiple alignments of the endoglucnase A domain (GrE) with other homologous protein GH5 domains and the endo-1,4-beta xylanase with other homologous protein GH10 domains

Full size image

The SMART sequence analysis indicated that the endo-1,4-beta xylanase had a Glycosyl hydrolase-10 domain. Similarly, a total of 25 endo-1,4-beta xylanase proteins were selected for the neighbor-joining phylogenetic analysis. The analysis depicts the evolutionary relationship between endo-1,4-beta xylanase and associated proteins, which revealed that the target enzyme from goat rumen is closely related to the homology protein from Ruminococcus albus (WP074961015.1) and Ruminococcus flavefaciens (WP074742329.1, Fig. 5c). The schematic structure of multiple sequence alignment indicating that the inferred amino acid sequence of a GH 10 family domain in endo-1,4-beta xylanase was aligned with those of selected homologous enzymes from the following microorganisms: Clostridium thermocellum (PDB ID: 2WYS), Ruminococcus callidus (WP_021681465.1), Ruminococcus albus (WP_074961015.1), Ruminococcus flavefaciens (WP_074742329.1), Polyplastron multivesiculatum (CAB65753.1), Ruminococcus champanellensis (WP_054685651.1). Signature sequences (in green rectangle) with detection of predicted catalytic residue (black arrow) were well aligned among all samples (Fig. 5d). Moreover, the protein shared around 59% amino acid sequence identity with 1,4-beta xylanase glycosyl hydrolase family 10 protein from Ruminococcus albus and 57% amino acid sequence identity with 1,4-beta xylanase family 10 protein from Ruminococcus flavefaciens (WP074742329.1).

Homology modelling and 3D structure prediction

The tertiary structures of endoglucanase A and endo-1,4-beta xylanase are shown in Fig. 6a, c. Ramachandran plot indicates the quality and stereochemistry of the structure that identifies the torsion angles of the residues in favored regions, allowed regions and outliers. In the case of endoglucanase A, 92% of the residues had torsion angles in favored regions, 5.9% residues were in allowed regions and only 2.1% of the residues were the outliers (Fig. 6b). Similarly, for endo-1,4-beta xylanase, among 293 residues, 92.7% of the residues were in favored regions, 6% residues were in allowed regions and only 1.3% of the residues were in the disallowed regions (Fig. 6d).

Fig. 6
figure 6

3D structure and overall composition analysis. Predicted 3D structure and overall composition (including alpha-helix, beta-sheet, bridge, turn and coil and 3–10 helix) of endoglucanase A (a), and endo-1,4-beta xylanase (c). Ramachandran plot analysis demonstrates the different residues falling in general favored (blue), general allowed (light blue), and glycine residues favored (yellow), glycine residue allowed (light yellow) for endoglucanase A (b), and endo-1,4-beta xylanase (d)

Full size image

STRIDE results suggested most of the secondary structures as coils and turns in the predicted protein structure. However, nine α-helices, ten β-strands and four 310 helices were also present in the predicted structure of the recombinant endoglucanase A. Similarly, the secondary structure of endo-1,4-beta xylanase comprised of eight α- helices, nine β-strands and three 310 helices along with coils and turns. In addition, the predicted model of the recombinant endoglucanase A and endo-1,4-beta xylanase was observed to be constituted of nineteen and thirteen salt bridges respectively (distances ≤ 3.2A).

Discussion

Metagenome screening is an invaluable technique for exploring the vast biodiversity of nature and uncovering novel enzymes, as it allows for direct analysis without the limitations in cultivation-based methods. The mining of a metagenomic library has facilitated the identification of microbial diversity and novel enzymes (cellulase and xylanase) from a variety of environmental samples, including soil, hot spring, termite’s gut, rumen of dairy cow [48,49,50,51]. Earlier study identified that experimental warming and the resultant decrease in soil moisture has a significant impact on microbial biodiversity by reducing the richness of bacteria (9.6%). Furthermore, a recent study successfully mined the camel rumen metagenome to identify a novel alkali-thermostable xylanase that could enhance the conversion of lignocellulosic biomass [52].

The goat rumen is home to a diverse community of microorganisms, including bacteria, protozoa, and fungi, which collectively contribute to the digestion of fibrous plant materials and the extraction of essential nutrients [53]. These microbes are adept at breaking down complex carbohydrates, such as cellulose and hemicellulose, into simpler sugars and short-chain fatty acids through fermentation processes [54]. This breakdown not only provides goats with a vital source of energy but also aids in the absorption of nutrients, including proteins and vitamins. Moreover, the microbial population in the rumen helps maintain the pH balance, ensuring efficient digestion and preventing conditions like acidosis [55]. Bacterial population is the most abundant in the rumen ecosystem comprising 1010 to 1011 cells/ml [56]. Studies have shown that the composition and diversity of rumen microbes can be influenced by various factors, including diet, genetics, and environmental conditions, highlighting the intricate relationship between rumen microbiota and goat health and nutrition [57, 58]. Understanding and optimizing this microbial ecosystem is crucial for enhancing goat productivity and overall well-being. For this reason, there is an utmost need for the comprehensive exploitation of goat rumen bacterial population. The goats that were used to extract the ruminant fluids in this study were on diet rich in cellulose and xylan. Here, we utilized genome-centric metagenomics strategy to explore diverse phylogeny, cellulose degrading potential bacterial enzymes housed in goat rumen. We successfully identified 19,780 glucanase and 43,692 beta-glucosidase for cellulose degradation, 20,881 xylanase and 18,295 xylosidase genes for hemicellulose/ xylan degradation, and 1,123 pectin methylesterase, 7,779 pectate lyase, and 5,852 polygalacturonase for pectin digestion in 3,327 bacterial strains from goat rumen samples. Eight bacterial strains were identified with a full spectrum of enzymes for cellulosic biomass digestion including Bacteroidals bacterium, Bacteroides sterorirosoris, Butyrivibrio proteoclasticus, Butyrivibrio sp INIIa14, Butyrivibrio sp Su6, and three Prevotella species. Findings from this study clearly confirmed the rich containment of cellulolytic genes/enzymes and microbes in the goat’s rumen fluids. Our data concur with reports that the rumen microbiomes of browse-feed animals contain a high variety of glycoside hydrolases indispensable for degrading plant cell wall materials [59,60,61,62]. In this goat rumen sample, Butyrivibrio proteoclasticus, Prevotella ruminicola, and Fibrobacter succinogenes were identified as the predominant bacteria in the goat’s rumen microbiomes. These bacterial species are known for the ability to efficiently degrade and use cellulose as a carbohydrate source, which could be the primary microbes for fiber degradation in goats as well as other ruminant animals [63,64,65]. In addition, Butyrivibrio proteoclasticus previously known as Clostridium proteoclasticum demonstrated the ability to convert linoleic acid into stearic acid in sheep rumen, suggesting its significant role in lipid metabolism [66]. Delgado's study explored into the rumen microbiota and feed efficiency traits of Holstein cattle, shedding light on the fact that cattle with high feed efficiency had a heightened presence of Bacteroidetes and Prevotella. These results emphasize the critical role played by microbiota composition in influencing feed utilization performance [67]. In research assessing the impact of hainanmycin (HAI) and monensin (MON) supplementation on ruminal protein metabolism and the populations of proteolytic bacteria in Holstein heifers, a notable increase in the abundance of Prevotella ruminicola was detected. This finding underscores the significant role these bacteria play in protein metabolism [68]. Given that the productivity of meat and milk relies heavily on the microbiota's efficiency in breaking down plant cell walls, and conversion into protein and lipids, the recognition of key rumen microbiota assumes a pivotal role in shaping strategies aimed at optimizing rumen fermentations for enhanced animal production.

In recent years, the search for novel biocatalysts with lignocellulose degradation functionality has gained an utmost attention. Fueled by the recent advancement of ‘omics’ techniques, numerous microbial enzymes have been developed and exploited for various industrial applications. For bio-fuel production as well as other bioconversion processes in paper, textile, food industries, where different treatments such as hot water, steam explosion, alkaline, solvent or acidic pretreatments are employed before or during enzyme treatment, robust enzymes that possess multiple extremophilic traits like thermos-alkaliphilic, thermosacidophilic, or multi-functionality characteristics have the potential to be particularly beneficial players. Earlier investigations by Zhang et al. unveiled a thermostable xylanase sourced from the salt tolerant Thermobifida halotolerans strain YIM90462. This enzyme exhibited remarkable xylanase activity at pH 9 and 70 °C, making it a compelling candidate for applications in pulp and paper bioleaching [69]. Additionally, a single fosmid harboring a cellulase enzyme, sourced from the buffalo rumen metagenomic library, exhibited exceptionally high cellulase activity, with its optimal operating conditions at pH 5.5 and 50 °C. This cellulase displayed robust stability under acidic pH conditions, indicating its promising suitability as a potential feed supplement for broiler chicken [70]. In a separate study, Motahar et al. uncovered an acidic-thermostable α-amylase enzyme, PersiAmy2, cloned from the sheep rumen metagenome. The recombinant PersiAmy2 expressed in E. coli BL21 (DE3) exhibited remarkable stability under diverse pH, temperature, and maintained its efficacy even in the presence of various ions, inhibitors, and surfactants, which can be promising candidate to enhance the quality of gluten-free bread [71]. Combining metagenome screening with PCR-based methods has resulted in the direct cloning of numerous new genes/enzymes from environmental samples. In this study, we used a sequence-based metagenomics dataset to screen cellulolytic and xylanolytic enzymes from uncultured bacteria in goat rumen fluid. We then cloned and expressed two genes encoding for endoglucanase A and endo-1,4-beta xylanase. The biochemical function of the two enzymes was analyzed by using carboxymethyl cellulose and oat xylan, respectively, as a sole carbon source. This process for characterization of various cellulases and xylanases enzymes from bacterial metagenomes in the goat rumen environment serves as a theoretical framework for better understanding of the regulation of cellulolytic enzyme production.

Multiple alignments of the endoglucnase A from goat rumen bacteria with its homologous proteins with a glycoside hydrolase family 5 (GH5) family domain indicated that they shared only around 51–56% amino acid sequence identity. Likewise, the alignment of the endo-1,4-beta xylanase to its homologous proteins containing a glycoside hydrolase family 10 domain (GH10) showed that they shared only around 57–59% identity similarity [72,73,74]. Salt bridges between catalytic residues play a vital role in facilitating intramolecular electron transfer (IET) by promoting interactions among catalytic residues and substrate [75]. Notably, the recombinant endoglucanase A gene examined in this study contains nineteen salt bridges. The endo-1,4-beta xylanase was detected with thirteen salt bridges. The occurrence of these salt bridges in various essential regions of the enzyme contributes to its resilience under diverse extreme physicochemical conditions [76]. This revelation underscores the novelty of the enzymes cloned in this investigation, emphasizing that they belong to previously uncharacterized species, indicative of their status as entirely new enzymes characterized by enhanced activity and thermostability. As for optimum pH, and temperature, our findings are consistent with previous studies indicating that the ideal temperature and pH for recombinant endoglucanases produced by cellulolytic rumen bacteria fall within the pH range of 5.0–7.0 and temperature range of 40–50 °C [70, 77,78,79]. In a previous study, recombinant expression of endoglucanase from Bacillus licheniformis ATCC 14580 in E. coli BL21 (DE3) resulted in an activity level of 1.5 U/ml under optimized conditions, using carboxymethylcellulose as the substrate [80]. Similarly, another endoglucanase, EG5B, derived from Paenibacillus sp. IHB B 3084, was cloned and expressed in E. coli BL21(DE3), exhibiting the highest enzymatic activity at 1.382 IU/ml [81]. In both studies, crude enzyme extracts were utilized for enzymatic activity analysis. In contrast, in a separate research endeavor, endoglucanase CenC from Clostridium thermocellum was purified before enzyme activity analysis, revealing an activity of 30 U/mg on CMC and 9 U/mg on avicel, respectively [82]. Remarkably, the endo-1,4-beta xylanase obtained from this study exhibited an optimum activity at temperature around 50 °C and pH 10 (within test range). Various previous studies have characterized xylanase enzymes from different sources, including goat rumen [83], marine bacteria [84], camel metagenomes [85], termite gut metagenomes [86], and yak rumen [87]. These xylanases exhibit moderate thermostability and display optimal activity at temperatures around 50–60 °C. Additionally, they tend to have an optimal pH around 8.0 and are functional in a pH range between 5.5 and 8.0. The recombinant xylanase investigated in our study displayed remarkable activity over a wide pH range, making it a promising candidate for industrial processes that demand alkaline conditions. In previous research, the endo-xylanase xynFCB, derived from the thermophilic bacterium Thermoanaerobacterium saccharolyticum NTOU1, was subjected to exogenous expression and purification in E. coli BL21. This enzyme exhibited its highest activity at 91 U/mg, when oat spelt was employed as the substrate [84]. Similarly, in a separate study, exogenous expression of the endo-β-1,4-xylanase XylH, originating from the gastrointestinal bacterium Microbacterium trichothecenolyticum HY-17, revealed optimal xylanolytic activity at a high level of 97 U/mg when oat spelt served as the substrate [88]. While the enzymatic activity analysis conducted in this study did not yield an exceptionally high hydrolysis rate, it's crucial to note that the enzyme preparation process did not incorporate a purification step. Consequently, the crude protein extraction included a mixture of various enzymes, potentially influencing the accuracy of the enzymatic activity evaluation.

Conclusions

In this study, we have demonstrated the process for investigating and utilizing metagenome resources. The findings from this study highlight the disproportionately significant role that rumen microbes in cellulosic biomass degradation. The in-depth analysis of the goat rumen bacterial metagenomes along with cloning, enrichment enzymatic assay, and in vitro enzyme characterization could serve as a rich resource for the biotechnology community engaged in unearthing novel strategy for lignocellulosic biomass conversion into CH4 rich products or other targets. We have demonstrated the process to clone novel genes from the metagenome and producing and characterization of recombinant cellulolytic enzymes. Designing consortia with both anaerobic bacteria and fungi could better aid in understanding the diverse physio-chemical parameters while offering knowledge base to create minimal systems for the bio-chemical conversion of lignocellulose into value added chemicals. While the current study did not assess the relative transcription levels of the identified CAZyme genes, it is worth noting that the microbial consortia detected could potentially encode a substantial number of CAZyme-associated genes that are part of enzyme-tethered systems. Even so, the dataset of goat rumen-derived genomes described in this study, along with publicly available rumen genomes, could serve as a valuable reference for future metagenomic investigations.

Availability of data and materials

The raw reads were deposited in the NCBI Sequence Read Archive (SRA) under accession number SRX2267715 and SRX2267714. The assembled scaffolds were deposited to the NCBI with accession number VKOM0000000000.1, VKOL000000000.1, and VKOK000000000.1 DOJ-JGI IMG annotation data can be retrieved from https://img.jgi.doe.gov/cgi-bin/m/main.cgi?section=TaxonDetail&page=taxonDetail&taxon_oid=3300001425.

Abbreviations

CAZymes:

Carbohydrate-Active EnZymes

CMC:

Carboxymethyl cellulose sodium salt

COG:

Cluster of orthologous groups

DNS:

Dinitrosalicyclic acid

GH:

Glycoside hydrolase

GMQE:

Global model quality estimation

IPTG:

Isopropyl β-D-1-thiogalactopyranoside

PDB:

Protein data bank

SDS-PAGE:

Sodium dodecyl sulfate polyacrylamide electrophoresis

SRA:

Sequence Read Archive

VMD:

Visual molecular dynamics

References

  1. Batista-García RA, del Rayo S-C, Talia P, Jackson SA, O’Leary ND, Dobson ADW, Folch-Mallol JL. From lignocellulosic metagenomes to lignocellulolytic genes: trends, challenges and future prospects. Biofuels Bioprod Biorefin. 2016;10:864–82.

    Article  Google Scholar 

  2. Zoghlami A, Paës G. Lignocellulosic biomass: understanding recalcitrance and predicting hydrolysis. Front Chem. 2019;7:874.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  3. Hill J, Nelson E, Tilman D, Polasky S, Tiffany D. Environmental, economic, and energetic costs and benefits of biodiesel and ethanol biofuels. Proc Natl Acad Sci. 2006;103:11206–10.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  4. Robak K, Balcerek M. Review of second generation bioethanol production from residual biomass. Food Technol Biotechnol. 2018;56:174.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  5. Jensen MB, De Jonge N, Dolriis MD, Kragelund C, Fischer CH, Eskesen MR, Noer K, Møller HB, Ottosen LDM, Nielsen JL. Cellulolytic and xylanolytic microbial communities associated with lignocellulose-rich wheat straw degradation in anaerobic digestion. Front Microbiol. 2021;12:645174.

    Article  PubMed  PubMed Central  Google Scholar 

  6. Chen KJ, Tang JC, Xu BH, Lan SL, Cao Y. Degradation enhancement of rice straw by co-culture of Phanerochaete chrysosporium and Trichoderma viride. Sci Rep. 2019;9:19708.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  7. Morgavi DP, Kelly WJ, Janssen PH, Attwood GT. Rumen microbial (meta) genomics and its application to ruminant production. Animal. 2013;7(s1):184–201.

    Article  PubMed  CAS  Google Scholar 

  8. Liu X, Liu Q, Sun S, Sun H, Wang Y, Shen X, Zhang L. Exploring AI-2-mediated interspecies communications within rumen microbial communities. Microbiome. 2022;10(1):167.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  9. Wu X, Spencer S, Gushgari-Doyle S, Yee MO, Voriskova J, Li Y, Alm EJ, Chakraborty R. Culturing of “Unculturable” subsurface microbes: natural organic carbon source fuels the growth of diverse and distinct bacteria from groundwater. Front Microbiol. 2020;11:3171.

    Article  Google Scholar 

  10. He S, Ivanova N, Kirton E, Allgaier M, Bergin C, Scheffrahn RH, Kyrpides NC, Warnecke F, Tringe SG, Hugenholtz P. Comparative metagenomic and metatranscriptomic analysis of hindgut paunch microbiota in wood-and dung-feeding higher termites. PLoS One. 2013;8(4):e61126.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  11. Warnecke F, Luginbühl P, Ivanova N, Ghassemian M, Richardson TH, Stege JT, Cayouette M, McHardy AC, Djordjevic G, Aboushadi N. Metagenomic and functional analysis of hindgut microbiota of a wood-feeding higher termite. Nature. 2007;450(7169):560–5.

    Article  PubMed  CAS  Google Scholar 

  12. Do TH, Nguyen TT, Nguyen TN, Le QG, Nguyen C, Kimura K, Truong NH. Mining biomass-degrading genes through Illumina-based de novo sequencing and metagenomic analysis of free-living bacteria in the gut of the lower termite Coptotermes gestroi harvested in Vietnam. J Biosci Bioeng. 2014;118(6):665–71.

    Article  PubMed  CAS  Google Scholar 

  13. Liu N, Zhang L, Zhou H, Zhang M, Yan X, Wang Q, Long Y, Xie L, Wang S, Huang Y. Metagenomic insights into metabolic capacities of the gut microbiota in a fungus-cultivating termite (Odontotermes yunnanensis). PLoS One. 2013;8(7):e69184.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  14. Sari WN, Fahrimal Y. Isolation and identification of a cellulolytic Enterobacter from rumen of Aceh cattle. Vet World. 2017;10(12):1515.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  15. Pang J, Liu ZY, Hao M, Zhang YF, Qi QS. An isolated cellulolytic Escherichia coli from bovine rumen produces ethanol and hydrogen from corn straw. Biotechnol Biofuels. 2017;10(1):1–10.

    Article  Google Scholar 

  16. Hess M, Sczyrba A, Egan R, Kim T-W, Chokhawala H, Schroth G, Luo S, Clark DS, Chen F, Zhang T. Metagenomic discovery of biomass-degrading genes and genomes from cow rumen. Science. 2011;331(6016):463–7.

    Article  PubMed  CAS  Google Scholar 

  17. Stewart RD, Auffret MD, Warr A, Wiser AH, Press MO, Langford KW, Liachko I, Snelling TJ, Dewhurst RJ, Walker AW, Roehe R. Assembly of 913 microbial genomes from metagenomic sequencing of the cow rumen. Nat Commun. 2018;9:870.

    Article  PubMed  PubMed Central  Google Scholar 

  18. Seshadri R, Leahy SC, Attwood GT, Teh KH, Lambie SC, Cookson AL, Eloe-Fadrosh EA, Pavlopoulos GA, Hadjithomas M, Varghese NJ, Paez-Espino D. Cultivation and sequencing of rumen microbiome members from the Hungate1000 Collection. Nat Biotechnol. 2018;36:359–67.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  19. Li J, Zhong H, Ramayo-Caldas Y, Terrapon N, Lombard V, Potocki-Veronese G, Estellé J, Popova M, Yang Z, Zhang H, Li F. A catalog of microbial genes from the bovine rumen unveils a specialized and diverse biomass-degrading environment. Gigascience. 2020;9:giaa057.

    Article  PubMed  PubMed Central  Google Scholar 

  20. Glendinning L, Genç B, Wallace RJ, Watson M. Metagenomic analysis of the cow, sheep, reindeer and red deer rumen. Sci Rep. 2021;11:1990.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  21. Han X, Lei X, Yang X, Shen J, Zheng L, Jin C, Cao Y, Yao J. A metagenomic insight into the hindgut microbiota and their metabolites for dairy goats fed different rumen degradable starch. Front Microbiol. 2021;12:651631.

    Article  PubMed  PubMed Central  Google Scholar 

  22. Nelson KE, Zinder SH, Hance I, Burr P, Odongo D, Wasawo D, Odenyo A, Bishop R. Phylogenetic analysis of the microbial populations in the wild herbivore gastrointestinal tract: insights into an unexplored niche. Environ Microbiol. 2003;5:1212–20.

    Article  PubMed  Google Scholar 

  23. An D, Dong X, Dong Z. Prokaryote diversity in the rumen of yak (Bos grunniens) and Jinnan cattle (Bos taurus) estimated by 16S rDNA homology analyses. Anaerobe. 2005;11:207–15.

    Article  PubMed  CAS  Google Scholar 

  24. Kittelmann S, Janssen PH. Characterization of rumen ciliate community composition in domestic sheep, deer, and cattle, feeding on varying diets, by means of PCR-DGGE and clone libraries. FEMS Microbiol Ecol. 2011;75:468–81.

    Article  PubMed  CAS  Google Scholar 

  25. Sundset MA, Præsteng KE, Cann IK, Mathiesen SD, Mackie RI. Novel rumen bacterial diversity in two geographically separated sub-species of reindeer. Microb Ecol. 2007;54:424–38.

    Article  PubMed  Google Scholar 

  26. Roehe R, Dewhurst RJ, Duthie CA, Rooke JA, McKain N, Ross DW, Hyslop JJ, Waterhouse A, Freeman TC, Watson M. Bovine host genetic variation influences rumen microbial methane production with best selection criterion for low methane emitting and efficiently feed converting hosts based on metagenomic gene abundance. PLoS Genet. 2016;12:e1005846.

    Article  PubMed  PubMed Central  Google Scholar 

  27. Ngwa AT, Dawson LJ, Puchala R, Detweiler G, Merkel RC, Tovar-Luna I, Sahlu T, Ferrell CL, Goetsch AL. Effect of initial body condition of Boer× Spanish yearling goat wethers and level of nutrient intake on body composition. Small Rumin Res. 2007;73:13–26.

    Article  Google Scholar 

  28. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19:455–77.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  29. Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011;17:10–2.

    Article  Google Scholar 

  30. Hyatt D, Chen GL, LoCascio PF, Land ML, Larimer FW, Hauser LJ. Prodigal: prokaryotic gene recognition and translation initiation site identification. BMC Bioinformatics. 2010;11:1–11.

    Article  Google Scholar 

  31. Huson DH, Beier S, Flade I, Górska A, El-Hadidi M, Mitra S, Ruscheweyh HJ, Tappu R. MEGAN community edition-interactive exploration and analysis of large-scale microbiome sequencing data. PLoS Comput Biol. 2016;12: e1004957.

    Article  PubMed  PubMed Central  Google Scholar 

  32. Segata N, Waldron L, Ballarini A, Narasimhan V, Jousson O, Huttenhower C. Metagenomic microbial community profiling using unique clade-specific marker genes. Nat Methods. 2012;9:811–4.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  33. Li H, Zhou S, Johnson T, Vercruysse K, Lizhi O, Ranganathan P, Phambu N, Ropelewski AJ, Thannhauser TW. Genome structure of Bacillus cereus tsu1 and genes involved in cellulose degradation and Poly-3-Hydroxybutyrate synthesis. Int J Polymer Sci. 2017;10:2017.

    Google Scholar 

  34. Huntemann M, Ivanova NN, Mavromatis K, Tripp HJ, Paez-Espino D, Tennessen K, Palaniappan K, Szeto E, Pillay M, Chen IM, Pati A, Nielsen T, Markowitz VM, Kyrpides NC. The standard operating procedure of the DOE-JGI Metagenome Annotation Pipeline (MAP vol 4). Stand Genomic Sci. 2016;11:17.

    Article  PubMed  PubMed Central  Google Scholar 

  35. Feng Y, Duan CJ, Pang H, Mo XC, Wu CF, Yu Y, Hu YL, Wei J, Tang JL, Feng JX. Cloning and identification of novel cellulase genes from uncultured microorganisms in rabbit cecum and characterization of the expressed cellulases. Appl Microbiol Biotechnol. 2007;75:319–28.

    Article  PubMed  CAS  Google Scholar 

  36. Meddeb-Mouelhi F, Moisan JK, Beauregard M. A comparison of plate assay methods for detecting extracellular cellulase and xylanase activity. Enzyme Microb Technol. 2014;66:16–9.

    Article  PubMed  CAS  Google Scholar 

  37. Miller GL. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem. 1959;31:426–8.

    Article  CAS  Google Scholar 

  38. George SP, Ahmad A, Rao MB. Studies on carboxymethyl cellulase produced by an alkalothermophilic actinomycete. Bioresour Technol. 2001;77:171–5.

    Article  PubMed  CAS  Google Scholar 

  39. Yin LJ, Huang PS, Lin HH. Isolation of cellulase-producing bacteria and characterization of the cellulase from the isolated bacterium Cellulomonas sp. YJ5. J Agric Food Chem. 2010;58:9833–7.

    Article  PubMed  CAS  Google Scholar 

  40. Zhang L, Fu Q, Li W, Wang B, Yin X, Liu S, Xu Z, Niu Q. Identification and characterization of a novel β-glucosidase via metagenomic analysis of Bursaphelenchus xylophilus and its microbial flora. Sci Rep. 2017;7:14850.

    Article  PubMed  PubMed Central  Google Scholar 

  41. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35:1547.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  42. Felsenstein J. Confidence limits on phylogenies: an approach using the bootstrap. Evolution. 1985;39:783–91.

    Article  PubMed  Google Scholar 

  43. Waterhouse A, Bertoni M, Bienert S, Studer G, Tauriello G, Gumienny R, Heer FT, de Beer TAP, Rempfer C, Bordoli L. SWISS-MODEL: homology modelling of protein structures and complexes. Nucleic Acids Res. 2018;46:W296–303.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  44. McGregor N, Morar M, Fenger TH, Stogios P, Lenfant N, Yin V, Xu X, Evdokimova E, Cui H, Henrissat B. Structure-function analysis of a mixed-linkage β-glucanase/xyloglucanase from the key ruminal bacteroidetes Prevotella bryantii B14. J Biol Chem. 2016;291:1175–97.

    Article  PubMed  CAS  Google Scholar 

  45. Lovell SC, Davis IW, Arendall WB III, de Bakker PI, Word JM, Prisant MG, Richardson JS, Richardson DC. Structure validation by Calpha geometry: Phi, psi and Cbeta deviation. Proteins. 2003;50:437–50.

    Article  PubMed  CAS  Google Scholar 

  46. Heinig M, Frishman D. STRIDE: a web server for secondary structure assignment from known atomic coordinates of proteins. Nucleic Acids Res. 2004;32:W500–2.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  47. Humphrey W, Dalke A, Schulten K. VMD: visual molecular dynamics. J Mol Graphics. 1996;14:33–8.

    Article  CAS  Google Scholar 

  48. Wu L, Zhang Y, Guo X, Ning D, Zhou X, Feng J, Yuan MM, Liu S, Guo J, Gao Z. Reduction of microbial diversity in grassland soil is driven by long-term climate warming. Nat Microbiol. 2022;7:1054–62.

    Article  PubMed  CAS  Google Scholar 

  49. Chan CS, Chan K-G, Tay Y-L, Chua Y-H, Goh KM. Diversity of thermophiles in a Malaysian hot spring determined using 16S rRNA and shotgun metagenome sequencing. Front Microbiol. 2015;6:177.

    Article  PubMed  PubMed Central  Google Scholar 

  50. Liu N, Li H, Chevrette MG, Zhang L, Cao L, Zhou H, Zhou X, Zhou Z, Pope PB, Currie CR. Functional metagenomics reveals abundant polysaccharide-degrading gene clusters and cellobiose utilization pathways within gut microbiota of a wood-feeding higher termite. ISME J. 2019;13:104–17.

    Article  PubMed  CAS  Google Scholar 

  51. Xue MY, Wu JJ, Xie YY, Zhu SL, Zhong YF, Liu JX, Sun HZ. Investigation of fiber utilization in the rumen of dairy cows based on metagenome-assembled genomes and single-cell RNA sequencing. Microbiome. 2022;10:11.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  52. Ariaeenejad S, Maleki M, Hosseini E, Kavousi K, Moosavi-Movahedi AA, Salekdeh GH. Mining of camel rumen metagenome to identify novel alkali-thermostable xylanase capable of enhancing the recalcitrant lignocellulosic biomass conversion. Bioresour Technol. 2019;281:343–50.

    Article  PubMed  CAS  Google Scholar 

  53. Palma-Hidalgo JM, Jiménez E, Popova M, Morgavi DP, Martín-García AI, Yáñez-Ruiz DR, Belanche A. Inoculation with rumen fluid in early life accelerates the rumen microbial development and favours the weaning process in goats. Animal Microbiome. 2021;3:1–21.

    Article  Google Scholar 

  54. Dao TK, Do TH, Le NG, Nguyen HD, Nguyen TQ, Le TT, Truong NH. Understanding the role of prevotella genus in the digestion of lignocellulose and other substrates in Vietnamese native goats’ rumen by metagenomic deep sequencing. Animals. 2021;11:3257.

    Article  PubMed  PubMed Central  Google Scholar 

  55. Kazemi M. An investigation on chemical/mineral compositions, ruminal microbial fermentation, and feeding value of some leaves as alternative forages for finishing goats during the dry season. AMB Express. 2021;11:1–3.

    Article  Google Scholar 

  56. Kamra DN. Rumen microbial ecosystem. Curr Sci. 2005;10:124–35.

    Google Scholar 

  57. Zielińska S, Kidawa D, Stempniewicz L, Łoś M, Łoś JM. New Insights into the Microbiota of the Svalbard Reindeer Rangifer tarandus platyrhynchus. Front Microbiol. 2016;7:170.

    Article  PubMed  PubMed Central  Google Scholar 

  58. Mao S, Zhang M, Liu J, Zhu W. Characterising the bacterial microbiota across the gastrointestinal tracts of dairy cattle: membership and potential function. Sci Rep. 2015;5:16116.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  59. Guerra V, Tiago I, Aires A, Coelho C, Nunes J, Martins LO, Veríssimo A. The gastrointestinal microbiome of browsing goats (Capra hircus). PLoS One. 2022;17:e0276262.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  60. Hinsu AT, Tulsani NJ, Panchal KJ, Pandit RJ, Jyotsana B, Dafale NA, Patil NV, Purohit HJ, Joshi CG, Jakhesara SJ. Characterizing rumen microbiota and CAZyme profile of Indian dromedary camel (Camelus dromedarius) in response to different roughages. Sci Rep. 2021;11:9400.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  61. Wang L, Hatem A, Catalyurek UV, Morrison M, Yu Z. Metagenomic insights into the carbohydrate-active enzymes carried by the microorganisms adhering to solid digesta in the rumen of cows. PLoS One. 2013;8:e78507.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  62. Lopes LD, de Souza Lima AO, Taketani RG, Darias P, da Silva LRF, Romagnoli EM, Louvandini H, Abdalla AL, Mendes R. Exploring the sheep rumen microbiome for carbohydrate-active enzymes. Antonie Van Leeuwenhoek. 2015;108:15–30.

    Article  PubMed  CAS  Google Scholar 

  63. Kelly WJ, Leahy SC, Altermann E, Yeoman CJ, Dunne JC, Kong Z, Pacheco DM, Li D, Noel SJ, Moon CD. The glycobiome of the rumen bacterium Butyrivibrio proteoclasticus B316T highlights adaptation to a polysaccharide-rich environment. PLoS One. 2010;5:e11942.

    Article  PubMed  PubMed Central  Google Scholar 

  64. Fondevila M, Dehority BA. Interactions between Fibrobacter succinogenes, Prevotella ruminicola, and Ruminococcus flavefaciens in the digestion of cellulose from forages. J Anim Sci. 1996;74:678–84.

    Article  PubMed  CAS  Google Scholar 

  65. Dodd D, Kocherginskaya SA, Spies MA, Beery KE, Abbas CA, Mackie RI, Cann IKO. Biochemical analysis of a β-D-xylosidase and a bifunctional xylanase-ferulic acid esterase from a xylanolytic gene cluster in Prevotella ruminicola 23. J Bacteriol. 2009;191:3328–38.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  66. Wallace RJ, Chaudhary LC, McKain N, McEwan NR, Richardson AJ, Vercoe PE, Walker ND, Paillard D. Clostridium proteoclasticum: a ruminal bacterium that forms stearic acid from linoleic acid. FEMS Microbiol Lett. 2006;265:195–201.

    Article  CAS  Google Scholar 

  67. Delgado B, Bach A, Guasch I, González C, Elcoso G, Pryce JE, Gonzalez-Recio O. Whole rumen metagenome sequencing allows classifying and predicting feed efficiency and intake levels in cattle. Sci Rep. 2019;9:11.

    Article  PubMed  PubMed Central  Google Scholar 

  68. Wang ZB, Xin HS, Bao J, Duan CY, Chen Y, Qu YL. Effects of hainanmycin or monensin supplementation on ruminal protein metabolism and populations of proteolytic bacteria in Holstein heifers. Anim Feed Sci Technol. 2015;201:99–103.

    Article  CAS  Google Scholar 

  69. Zhang F, Hu SN, Chen JJ, Lin LB, Wei YL, Tang SK, Xu LH, Li WJ. Purification and partial characterisation of a thermostable xylanase from salt-tolerant Thermobifida halotolerans YIM 90462T. Process Biochem. 2012;47:225–8.

    Article  CAS  Google Scholar 

  70. Nguyen NH, Maruset L, Uengwetwanit T, Mhuantong W, Harnpicharnchai P, Champreda V, Tanapongpipat S, Jirajaroenrat K, Rakshit SK, Eurwilaichitr L, Pongpattanakitshote S. Identification and characterization of a cellulase-encoding gene from the buffalo rumen metagenomic library. Biosci Biotechnol Biochem. 2012;76:1075–84.

    Article  PubMed  CAS  Google Scholar 

  71. Motahar SF, Ariaeenejad S, Salami M, Emam-Djomeh Z, Mamaghani AS. Improving the quality of gluten-free bread by a novel acidic thermostable α-amylase from metagenomics data. Food Chem. 2021;352:129307.

    Article  Google Scholar 

  72. Liu L, Feng Y, Duan CJ, Pang H, Tang JL, Feng JX. Isolation of a gene encoding endoglucanase activity from uncultured microorganisms in buffalo rumen. World J Microbiol Biotechnol. 2009;25:1035–42.

    Article  Google Scholar 

  73. Nguyen KHV, Dao TK, Nguyen HD, Nguyen KH, Nguyen TQ, Nguyen TT, Nguyen TMP, Truong NH, Do TH. Some characters of bacterial cellulases in goats’ rumen elucidated by metagenomic DNA analysis and the role of fibronectin 3 module for endoglucanase function. Anim Biosci. 2021;34:867.

    Article  PubMed  CAS  Google Scholar 

  74. Moon YH, Iakiviak M, Bauer S, Mackie RI, Cann IKO. Biochemical analyses of multiple endoxylanases from the rumen bacterium Ruminococcus albus 8 and their synergistic activities with accessory hemicellulose-degrading enzymes. Appl Environ Microbiol. 2011;77:5157–69.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  75. Johnson-Winters K, Davis AC, Arnold AR, Berry RE, Tollin G, Enemark JH. Probing the role of a conserved salt bridge in the intramolecular electron transfer kinetics of human sulfite oxidase. J Biol Inorg Chem. 2013;18:645–53.

    Article  PubMed  CAS  Google Scholar 

  76. Teng C, Jiang Y, Xu Y, Li Q, Li X, Fan G, Xiong K, Yang R, Zhang C, Ma R, Zhu Y. Improving the thermostability and catalytic efficiency of GH11 xylanase PjxA by adding disulfide bridges. Int J Biol Macromol. 2019;128:354–62.

    Article  PubMed  CAS  Google Scholar 

  77. Gong X, Gruninger RJ, Qi M, Paterson L, Forster RJ, Teather RM, McAllister TA. Cloning and identification of novel hydrolase genes from a dairy cow rumen metagenomic library and characterization of a cellulase gene. BMC Res Notes. 2012;5:1–11.

    Article  Google Scholar 

  78. Cheng J, Huang S, Jiang H, Zhang Y, Li L, Wang J, Fan C. Isolation and characterization of a non-specific endoglucanase from a metagenomic library of goat rumen. World J Microbiol Biotechnol. 2016;32:1–8.

    Article  Google Scholar 

  79. Meng Z, Yang C, Leng J, Zhu W, Cheng Y. Production, purification, characterization and application of two novel endoglucanases from buffalo rumen metagenome. J Anim Sci Biotechnol. 2023;14:16.

    Article  PubMed  PubMed Central  CAS  Google Scholar 

  80. Aftab S, Aftab MN, Javed MM, Zafar A, Iqbal I. Cloning and expression of endo-1, 4-[beta]-glucanase gene from Bacillus licheniformis ATCC 14580 into Escherichia coli BL21 (DE 3). Afr J Biotech. 2012;11:2846.

    CAS  Google Scholar 

  81. Dhar H, Kasana RC, Gulati A. Heterologous expression and characterization of detergent stable endoglucanase EG5B from Paenibacillus sp. IHB B 3084. J Mol Catalysis B Enzymatic. 2015;120:9–15.

    Article  CAS  Google Scholar 

  82. Haq IU, Akram F, Khan MA, Hussain Z, Nawaz A, Iqbal K, Shah AJ. CenC, a multidomain thermostable GH9 processive endoglucanase from Clostridium thermocellum: cloning, characterization and saccharification studies. World J Microbiol Biotechnol. 2015;31:1699–710.

    Article  PubMed  Google Scholar 

  83. Lepcha K, Basak A, Kanoo S, Sharma P, BK P, Ghosh S. Thermoxylanolytic and thermosaccharolytic potential of a heat adapted bacterial consortium developed from goat rumen contents. Front Energy Res. 2021;9:755779.

    Article  Google Scholar 

  84. Hung KS, Liu SM, Tzou WS, Lin FP, Pan CL, Fang TY, Sun KH, Tang SJ. Characterization of a novel GH10 thermostable, halophilic xylanase from the marine bacterium Thermoanaerobacterium saccharolyticum NTOU1. Process Biochem. 2011;46:1257–63.

    Article  CAS  Google Scholar 

  85. Ariaeenejad S, Hosseini E, Maleki M, Kavousi K, Moosavi-Movahedi AA, Salekdeh GH. Identification and characterization of a novel thermostable xylanase from camel rumen metagenome. Int J Biol Macromol. 2019;126:1295–302.

    Article  PubMed  CAS  Google Scholar 

  86. Nimchua T, Thongaram T, Uengwetwanit T, Pongpattanakitshote S, Eurwilaichitr L. Metagenomic analysis of novel lignocellulose-degrading enzymes from higher termite guts inhabiting microbes. J Microbiol Biotechnol. 2012;22:462–9.

    Article  PubMed  CAS  Google Scholar 

  87. Zhou J, Bao L, Chang L, Liu Z, You C, Lu H. Beta-xylosidase activity of a GH3 glucosidase/xylosidase from yak rumen metagenome promotes the enzymatic degradation of hemicellulosic xylans. Lett Appl Microbiol. 2012;54:79–87.

    Article  PubMed  CAS  Google Scholar 

  88. Kim DY, Shin DH, Jung S, Kim H, Lee JS, Cho HY, Bae KS, Sung CK, Rhee YH, Son KH, Park HY. Novel Alkali-Tolerant GH10 Endo-β-1, 4-Xylanase with Broad Substrate Specificity from Microbacterium trichothecenolyticum HY-17, a Gut Bacterium of the Mole Cricket Gryllotalpa orientalis. J Microbiol Biotechnol. 2014;24(7):943–53.

    Article  PubMed  CAS  Google Scholar 

Download references

Acknowledgements

We would like to thank Drs Charles Lee and Theodore Thannhauser at USDA/ARS for their guidance in performing this research project. The authors wish to thank Dr. Ryszard Puchala at Langston University for providing goat’s rumen fluid samples.

Funding

This work received support from the USDA-NIFA 1890 Capacity Building Grants Program (2018–38821-27737 and 2010–38821-21598). And the Extreme Science and Engineering Discovery Environment (NSF grant OCI 1053575 Specifically, it used Bridges systems which are supported by NSF award numbers ACI 1445606 at the Pittsburgh Supercomputing Center.

The work also received support through the XSEDE Extended Collaborative Support Services and the XSEDE Campus Champions program.

Author information

Authors and Affiliations

  1. Department of Agricultural and Environmental Sciences, College of Agriculture, Tennessee State University, 3500 John A. Merritt Blvd, Nashville, TN, 37209, USA

    Santosh Thapa, Suping Zhou & Hui Li

  2. Vanderbilt University Medical Center, 2215 Garland Ave, Nashville, TN, 37232, USA

    Santosh Thapa

  3. Department of Biological Sciences, College of Life & Physical Sciences, Tennessee State University, 3500 John A. Merritt Blvd, Nashville, TN, 37209, USA

    Joshua O’Hair

  4. Department of Computer Sciences, College of Engineering, Tennessee State University, 3500 John A. Merritt Blvd, Nashville, TN, 37209, USA

    Kamal Al Nasr

  5. Pittsburgh Supercomputing Center, 300 S. Craig Street, Pittsburgh, PA, 15213, USA

    Alexander Ropelewski

Authors
  1. Santosh Thapa
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Suping Zhou
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Joshua O’Hair
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Kamal Al Nasr
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Alexander Ropelewski
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Hui Li
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

SZ and ST designed the study; ST, HL performed DNA extraction, gene cloning and enzyme characterization; ST, HL, AR and ANK conducted bioinformatics and data analysis; ST and HL wrote original draft; SZ, JO reviewed and edited the manuscript. All authors have read and agreed to publish the final version of the manuscript.

Corresponding author

Correspondence to Hui Li.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1:

 Table S1. Primers for gene cloning from goat rumen bacterial DNA. Table S2. Microbial community analysis using Metaphlan. Table S3. Gene counts of CAZymes annotated by DOE-JGI pipelines. Table S4. Cellulase and hemicellulase genes deposited into NCBI database with accession number. Figure S1. SDS-PAGE analysis of the recombinant proteins. (+) are crude extract of IPTG induced endo 1, 4 beta xylanase (left) around 37kD and endoglucanase A (right) around 38kDa; (+/-) are crude extract with no IPTG induction; (-) are an IPTG induced crude extract of an empty vector (negative control).

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Thapa, S., Zhou, S., O’Hair, J. et al. Exploring the microbial diversity and characterization of cellulase and hemicellulase genes in goat rumen: a metagenomic approach. BMC Biotechnol 23, 51 (2023). https://doi.org/10.1186/s12896-023-00821-6

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s12896-023-00821-6

Keywords

BMC Biotechnology

ISSN: 1472-6750

Contact us