Skip to main content

Table 2 Primers used in this study

From: Characterisation of three novel α-L-arabinofuranosidases from a compost metagenome

Primer 5′ to 3′ sequencea Reference
T7 Promoter forward TAATACGACTCACTATAGGG Epicentre® Biotechnologies
pCC1Fos reverse CTCGTATGTTGTGTGGAATTGTGAGC Epicentre® Biotechnology
MUKAN-1 FP-1 CTGGTCCACCTACAACAAAGG Epicentre® Biotechnologies
MUKAN-1 RP-1 AGAGATTTTGAGACAGGATCCG Epicentre® Biotechnologies
M13 Forward CCCAGTCACGACGTTGTAAAACG Inqaba Biotec
M13 Reverse AGCGGATAACAATTTCACACAGG Inqaba Biotec
H4-pET-Fwd GTTCATATGAATCACATCAAGATTGATTTAGAT This Study
H4-pET-Rev CGCTCGAGTAAGTCAAAGCTGAGC This Study
E3-pET-Fwd ATCATATGGACGGAGGCGCATGCG This Study
E3-pET-Rev CAAGCTTGGACGGTCGGCGG This Study
D3-pET-Fwd GATCATATGAACAATGTCGTCATCAATGTGG This Study
D3-pET-Rev CTTCTCGAGACCTAATCTTAGAATGCCGAC This Study
  1. aThe restriction endonuclease sites incorporated into the PCR primers include XhoI, NdeI and HindIII indicated as bold nucleotides