Skip to main content

Table 1 PCR primers used in this study

From: The Flp double cross system a simple efficient procedure for cloning DNA fragments

# Primer name Primer sequence (5'-3') Features Amplifies
1. FRT 5' (Bam) LacZ tcaggcgcgccgtcgaccatatg gaagttcctatac tttctaga gaataggaacttc g gaataggaacttc GGATCC caaaccgcctctccccgcgc Buffer sequence FRT site BamHI site lac sequence 97 nt 591 bp of lac promoter, operator and lacZ (including primers). 5' end begins at nt# 1081 of J01636 (GI146575)
2. FRT inverse 3' (RI) LacZ catggcgcgccgtcgaccatatg gaagttcctatac tttctaga gaataggaacttc g gaataggaacttc GAATTC ccggaaaccaggcaaagcg Buffer sequence FRT site EcoRI site lacZ sequence 96 nt 591 bp of lac promoter, operator and lac Z (including primers). 5' end begins at nt# 1479 of J01636 (GI146575)
3. FRT 5' (Bam) KvDMR tcaggcgcgccgtcgaccatatg gaagttcctatac tttctaga gaataggaacttc g gaataggaacttc GGATCC agtgggggcttcagaacatc Buffer sequence FRT site BamHI site KvDMR sequence 97 nt 1679 bp of intron 10 of human KCNQ1 gene(including primers). 5'end begins at nt #68364 of accession # U90095
4. FRT inverse 3' (RI) KvDMR catggcgcgccgtcgaccatatg gaagttcctatac tttctaga gaataggaacttc g gaataggaacttc GAATTC gattccagactccaatccca Buffer sequence FRT site EcoRI site KvDMR sequence 97 nt 1679 bp of intron 10 of human KCNQ1 gene (including primers). 5'end begins at nt #66879 of accession # U90095