Skip to main content

Table 2 Primers used for retargeting

From: Rapid targeted gene disruption in Bacillus anthracis

Primer name Primer sequence Pairings changed
IS605-435|436 s AAAAAAGCTTATAATTATCCTTAAAATACAGTGTAGTGCGCCCAGATAGGGTG IBS1/2
IS605-435|436 s CAGATTGTACAAATGTGGTGATAACAGATAAGTCAGTGTAGATAACTTACCTTTCTTTGT EBS1/δ
IS605-435|436 s TGAACGCAAGTTTCTAATTTCGGTTTATTTCCGATAGAGGAAAGTGTCT EBS2
BAS4553-343|344 s AAAAAAGCTTATAATTATCCTTAGATGCCCGTACGGTGCGCCCAGATAGGGTG IBS1/2
BAS4553-343|344 s CAGATTGTACAAATGTGGTGATAACAGATAAGTCCGTACGGCTAACTTACCTTTCTTTGT EBS1/δ
BAS4553-343|344 s TGAACGCAAGTTTCTAATTTCGATTGCATCTCGATAGAGGAAAGTGTCT EBS2
BAS4597-1794|1795 s AAAAAAGCTTATAATTATCCTTACGAAACGAGAAAGTGCGCCCAGATAGGGTG IBS1/2
BAS4597-1794|1795 s CAGATTGTACAAATGTGGTGATAACAGATAAGTCGAGAAAGATAACTTACCTTTCTTTGT EBS1/δ
BAS4597-1794|1795 s TGAACGCAAGTTTCTAATTTCGGTTTTTCGTCGATAGAGGAAAGTGTCT EBS2
EBS-Universal AACCGAAATTAGAAACTTGCGTTCA None
  1. The primers shown were used in PCR to generate a HindIII BsrG1 fragment that was exchanged into the Targetron vectors and retarget the intron to the genomic location indicated in the primer name. The exact nucleotide the intron is designed to insert at is designated by a | at the genomic location indicated above the primer sequences.