Skip to main content

Table 1 Targetron insertion sites and scores

From: Rapid targeted gene disruption in Bacillus anthracis

Gene insertion site -30 to -1 NT upstream LtrB intron +1 to +15 NT downstream Score
IS605 435|436 s CCGATTATAGATCATCAAAAATATAGTGTA gtgc…tcac GAAATTATTCGCAAA 9.3
BAS4553 343|344 s GTTCAAATGGATTATACGGATGCACGTACG gtgc…tcac GCTTTTTGGAAGTGT 8.4
BAS4597 1794|1795 s AATCAATTAGATTGGGATCGAAAAGAGAAA gtgc…tcac GAAATAGAGACCGTT 7.3
  1. The gene chosen for intron insertion is shown in the first column with the nucleotide positions at which the intron is designed to insert at within the gene shown beside the gene name. All intron insertions are in the sense orientation relative to gene transcription and designated here with the suffix “s”. The sequence of 30 nucleotides upstream and 15 nucleotides downstream of the intron insertion site are shown together with a numeric score reflecting expected efficiency based on a learning set of Ll.Ltrb intron insertions.