Adsorption characteristics of an enteric virus-binding protein to norovirus, rotavirus and poliovirus

BMC Biotechnology

Table 1 Primers used in this study

Primer	Sequence (5' - 3')	Length	Position^a	Product size
EVBP-SP1-F	aaccgacatcctggcgattg	20	658	1823
EVBP-SP1-R	caaacccagtgcacgcatac	20	2480
EVBP-SP2-F	cgaagcgtaatccacccttt	20	679	1713
EVBP-SP2-R	agccgtttggtaaccaagac	20	2391
EVBP-FW	caccatggcagctaaagaag	20	729^b	1634^c
EVBP-RV	ttacaccatgcccatgccac	20	2358

a, position in the Aeromonas salmonicida chaperonin GroES and chaperonin GroEL genes, complete cds (AF030975.1); b, without 5'-cacc-3' region; c, with 5'-cacc-3' region.

ISSN: 1472-6750