Skip to main content

Table 2 Primers and probes used for plasmid construction and real-time quantitative PCR

From: An effective combination of codon optimization, gene dosage, and process optimization for high-level production of fibrinolytic enzyme in Komagataella phaffii (Pichia pastoris)

  Sequence (5′ → 3′) Annotation
fib-F GAATTCGCAGGGAAATCAAACGGG PCR for pPIC9K-fib
fib-R GCGGCCGCTTAGTGGTGATGATGGTGATGTTGAGCAGCAGCTTGAACGT PCR for pPIC9K-fib
fib-F GCAGGGAAATCAAACGGG PCR for pMD19T-fib
fib-R TTGAGCAGCAGCTTGAACGT PCR for pMD19T-fib
TDH1-F ATGGCTATCACTGTCGGTATTAACG PCR for pMD19T-TDH1
TDH1-R TTAAGCCTTAGCAACGTGTTG PCR for pMD19T-TDH1
qfib-F TTGCCGGTGGAGCTTCTATG qPCR for fib
qfib-R CAACAGAGTTGTTCAAAGCAGCA qPCR for fib
Probe-fib HEX-TCCATTCCAAGATTACAACTCTCATGG-BHQ-1 qPCR for fib
qTDH1-F CGGTGTTTTCACCACTTTGGA qPCR for TDH1
qTDH1-R CAACGAACATTGGAGCATCCT qPCR for TDH1
Probe-TDH1 HEX-CCAAAAGCACATCGACGCCGGT-BHQ-1 qPCR for TDH1