Skip to main content

Table 6 Specific SSR and SCAR primers used for detection of CMD2 resistant gene in cassava mother plants and regenerated plantlets

From: In vitro propagation of three mosaic disease resistant cassava cultivars

Primer code Marker system Forward primer sequence Reverse primer sequence Expected sequence length (bp) Annealing
Temperature (°C)
NS169 SSR GTGCGAAATGGAAATCAATG GCCTTCTCAGCATATGGAGC 319 55
RME1 SCAR AGAAGAGGGTAGGAGTTATGT ATGTTAATGTAATGAAAGAGC 700 55