Skip to main content

Table 2 Oligonucleotide sequences used in this study

From: Loop-mediated isothermal amplification (LAMP) reaction as viable PCR substitute for diagnostic applications: a comparative analysis study of LAMP, conventional PCR, nested PCR (nPCR) and real-time PCR (qPCR) based on Entamoeba histolytica DNA derived from faecal sample

PrimersSequences (5′-3′)Length (mer)Product size
Loop-Mediated Isothermal Amplification
 Eh-FIP-SERGCTTCGTTCTTTAAAAATACACCGTCATTCTTGATTTGGATCAAGAAGT49
 Eh-BIP-SERAGTAGCTCAGCAAAACCAGAATCACTTGCTTTTTCATCTTCATCA45
 Eh-F3-SERTGCATTCACTAGTGCAACT19
 Eh-B3-SERGCTTGATTCTGAGTTATCACTTG23
 Eh-LB-SERAAGTTCAAATGAAGATAATGAA22
Conventional PCR & Real-Time PCR
 Eh-F2CATTCTTGATTTGGATCAAGAAGT24175 bp
 Eh-B2ACTTGCTTTTTCATCTTCATCA22
Nested PCR
 Eh-F3-SERTGCATTCACTAGTGCAACT19223 bp
 Eh-B3-SERGCTTGATTCTGAGTTATCACTTG23
 Eh-F2CATTCTTGATTTGGATCAAGAAGT24175 bp
 Eh-B2ACTTGCTTTTTCATCTTCATCA22