Skip to main content

Advertisement

Table 2 The primers of qRT-PCR

From: Identification and characterization of an Endo-glucanase secreted from cellulolytic Escherichia coli ZH-4

Primers Sequences (5′-3′)
bcsZ-F GAGAACAGTAAGTGGGAAGTGC
bcsZ-R AACGCTGCTCTTTCCACAAACG
16S rRNA-F GCTCAACCTGGGAACTGC
16S rRNA-R CCACGCTTTCGCACCTGA