Skip to main content

Table 2 List of primers used for the construction of tethered eCG mutants

From: Characterization of tethered equine chorionic gonadotropin and its deglycosylated mutants by ovulation stimulation in mice

  Primer name Location Primer Sequence
1 eCGβ/α β-subnuit - 5′- TGAATTCACCATGGAGACGGTCCAG -3′
Eco R I site
2 myc eCGβ/α reverse - 5′- TCCATCAGGAAAAGAAGTCTTTATTGG -3′
3 myc eCGβ/α forward - 5′- ATAAAGACTTCTTTTCCTTGATGGAGAG -3′
4 eCGβ/αΔ56 reverse α 56 5′- TGAGGTGATCTGCTTTGGGACCAACAT -3′
5 eCGβ/αΔ56 forward α 56 5′- ATGTTGGTCCCAAAGCAGATCACCTCA -3′
6 eCGβ/αΔ82 reverse α 82 5′- GGCCTCCTTCTCAGCGGCCAGAGTGGCGTTGAT -3′
7 eCGβ/αΔ82 forward α 82 5′- ATCAACGCCACTCTGGCCGCTGAGAAGGAGGCC -3′
8 eCGβΔ13/α reverse β 13 5′- AGCAGCCAGAGTGGCGTTGATGGGCCGGCACAG -3′
9 eCGβΔ13/α forward β 13 5′- CTGTGCCGGCCCATCAACGCCACTCTGGCTGCT -3′
10 eCGβ-D/α reverse β : 121-149 5′- TCCATCAGGAAAGGCCTGGGGGGCACAGGC -3′
11 eCGβ-D/α forward β : 121-149 5´- GCCCCCCAGGCCTTTCCTCATGGAGAGTTT -3´
12 eCGβ/α α-subunit - 5′- CCGTCGACTTTAAATCTTGTGGTGATAGCA -3′
Sal I site