Skip to main content

Table 1 Sequence information for artificial 35Sp LAMP templates

From: Lack of specificity associated with using molecular beacons in loop mediated amplification assays

Target, Notation, Version Template Sequence (5’ to 3’)
35Sp BIP Dumbbell, LOOPS, PH CACGTCTTCAAAGCAAGTGGGGATAGTGGGAT
  TGTGCGTCCCCTTACGTCAGTGGACCACTTGC
  TTTGAAGACGTGGTCTAGATTCCACGATGCTC
  CTCGGGGGTCCATCTTTGGGCCACTGTCGGCA
  GAGGCGAGGAGCATCGTGGAA
35Sp partial sequence, LINEAR, PH TTGCGATAAAGGAAAGGCCATCGTTGAAGATG
  CCTCTGCCGACAGTGGTCCCAAAGATGGACCC
  CCACCCACGAGGAGCATCGTGGAAAAAGAAGA
  CGTTCCAACCACGTCTTCAAAGCAAGTGGATT
  GATGTGATATCTCCACTGACGT
  1. 35Sp templates synthesised and PAGE purified by IDT (Coralville, Iowa, USA). Both oligonucleotides are 150 bases in length, diluted to 10 micromolar and stored at minus 20 degrees C
\