Skip to main content

Table 2 LASSO long adapter sequence

From: Quantitative assessment of LASSO probe assembly and long-read multiplexed cloning

Sequence Name Sequence (5′-3′)
Long Adapter for Multiplexed LASSO Probes AGAGAAGTCCTAGCACGGTAACCTCCGAGGATGTCATCAAAGAGTTTAAAGAGTTTATGAGATTTAAGGTCAAGATGGAGGGAAGCGTCAACGGACACGAGTTCGAGATTGAGGGAGAAGGAGAAGGCCGGCCTTACGAGGGCACACAAACCGCTAAGCTCAAGGTCACAAAAGGAGGACTAACTATAACGGTCCTAAGGTAGCGAACCCTCCCCTTCTCCTGGGATATTCTGAGCCCTCAGTTCCAGTACGGAAGCGAATTCCAGCTT