Skip to main content

Table 1 Sequences of primers used for real-time PCR analysis

From: MicroRNA-218 promotes early chondrogenesis of mesenchymal stem cells and inhibits later chondrocyte maturation

Name Forward primer (5’-3’) Reverse primer (5’-3’)
Chondrogenic markers
 Sox9 TGGCAAGGCTGACCTGAAG GCTCAGCTCGCCGATGT
 Col2a1 TCCTGGCCTCGTGGGT GGGATCCGGGAGAGCCA
 Aggrecan GCCACTGTTACCGCCACTT CACTGGCTCTCTGCATCCA
 COMP(cartilage oligomeric matrix protein) ACTGCCTGCGTTCTAGTGC CGCCGCATTAGTCTCCTGAA
Osteogenic markers
 ALP CCCTTCACTGCCATCCTGTAC CCATGGAGACGTTCTCTCTCTCA
 BSP (bone sialoprotein) ATGCCTGCCTTGTACCACGAGC TCCATCGAAGAATCAAAGCAGAG
 Col1a1 CCGTGCCCTGCCAGATC CAGTTCTTGATTTCGTCGCAGATC
 OCN(Osteocalcin) GGCAGGGAAGTCAGGGTAG CCCGTGGTTTCCTGGTC
 OPN(Osteopontin) GTACCCTGATGCTACAGACG TTCATAACTGTCCTTCCCAC
Mature markers
 CMP(cartilage matrix protein) AAGAACGACGACCAAAAGGAC CATCCCCTATACCATCGCCA
 Col10a1 GGCCCGGCAGGTCATC TGGGATGCCTTTTGGTCCTT
 MMP-13 AGTTTGGCCATTCCTTAGGTCTTG GGCTTTTGCCAGTGTAGGTATAGAT
 VEGF GGCTGGCAACATAACAGAGAA CCCCACATCTATACACACCTCC
 β-actin CTGAACCCTAAGGCCAACCG GTCACGCACGATTTCCCTCTC