Skip to main content

Table 1 PCR primers used in the present study

From: Characterization of a strong and constitutive promoter from the Arabidopsis serine carboxypeptidase-like gene AtSCPL30 as a potential tool for crop transgenic breeding

Name Forward (5′-3′) Reverse (5′-3′)
P AtSCPL30FR ctaatctcaatgtttccgcctttc cacatgaaaccatttctactaatat
PD1FR atcggatccctaatctcaatgtttccgc attccatggttgaggctaggttttagtag
PD2FR atcggatccaagggaactacgcaaga attccatggttgaggctaggttttagtag
PD3FR atcggatccctgctttcgatcatttc attccatggttgaggctaggttttagtag
PD4FR atcggatccatggagttagagtttac attccatggttgaggctaggttttagtag
PD5FR atcggatcctaagtcgatcaatccgc attccatggttgaggctaggttttagtag
PD6FR atcggatccccgaatccacgaaac attccatggttgaggctaggttttagtag
PD7FR atcggatccataggcaaccgtggact attccatggttgaggctaggttttagtag
PD8FR atcggatccttatccctgtaaatcc attccatggttgaggctaggttttagtag
PD9FR atcggatccgctaccaatttaccaca attccatggttgaggctaggttttagtag
P CaMV35SFR aatggatccaagtctcaatagcccttt tgagaattccgtattggctagagcagc
PD7-8FR atcggatccataggcaaccgtggact agcctgcagattcgaatgaattcgtatat
PD8–9 FR atcggatccttatccctgtaaatcct aagctgcagggtagctttagtttattga
PD7-9FR atcggatccataggcaaccgtggact aagctgcagggtagctttagtttattga
HPTFR cgtctgctgctccatacaa tgtcctgcgggtaaatagc
P ZmUbi-1FR gataagcttctgcagaagtaacaccaaacaatcg agcggatccgcatgcctgcagtgcaactttatat
  1. The underlined sites are the sites for the digestion of restriction enzymes BamHI. The underlined italicized sites are the sites for the digestion of restriction enzymes NcoI. The sites in bold are the sitess for the digestion of restriction enzymes PstI. The italicized site is the site for the digestion of restriction enzymes Hin