Skip to main content

Table 2 Oligonucleotides used in this work

From: Conversion of an inactive xylose isomerase into a functional enzyme by co-expression of GroEL-GroES chaperonins in Saccharomyces cerevisiae

Oligonucleotide Sequence
XIO_F 5’ATGGCTGATCTGTGGAACAT3’
XIO_R 5’TCAGGCCTGGGCCAGG3’
XIO_h_pTDH1_F 5’TTCACTAAATTTACACACAAAACAAAATGGCTGATCTGTGGAACAT3’
XIO_h_tTDH1_R 5’TCATTATCCTCATCAAGATTGCTTTATTCAGGCCTGGGCCAG3’
XIOrp_F 5’ATGACTAAAGAATATTTTCCAAC3’
XIOrp_R 5’TTATTGGTACATGGCAACA3’
XIOrp_h_pTDH1_F 5’TCACTAAATTTACACACAAAACAAAATGACTAAAGAATATTTTCCAAC3’
XIOrp_h_tTDH1_R 5’ATTATCCTCATCAAGATTGCTTTATTTATTGGTACATGGCAACA3’
XI2.0_F 5’ATGGCAGATCTCTGGAAT3’
XI2.0_R 5’TTATGCTTGGGCTAAGGC3’
XI2.0_h_pTDH1_F 5’TCACTAAATTTACACACAAAACAAAATGGCAGATCTCTGGAAT3’
XI2.0_h_tTDH1_R 5’ATTATCCTCATCAAGATTGCTTTATTTATGCTTGGGCTAAGGC3’
pTDH1_F 5’TGGTGGATCCATGGCTGATCTGTGGAACAT3’
pTDH1_R 5’TTTGTTTTGTGTGTAAATTTAG3’
pTDH1_h_pRS426_F 5’GATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCAATGTATATGCTCATTTACAC3’
tTDH1_F 5’ATAAAGCAATCTTGATGAGG3’
tTDH1_R 5’CCTGGCCCAGGCCTGAAAGCTTGCGG3’
tTDH1_h_pRS426_R 5’TATTGCTGCCTTTGCAAGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCC3’
GroEL_h_pPGK_F 5’AAGGAAGTAATTATCTACTTTTTACAACAAATATAAAACAATGGCTGCTAAGGACGTTAA3’
GroEL_h_tPGK_R 5’AAAGAAAAAAATTGATCTATCGATTTCAATTCAATTCAATTTACATCATACCACCCATAC3’
GroES_h_pADH1_F 5’TCAAGCTATACCGAGCATACAATCAACTATCTCATATACAATGAACATCAGACCATTGCA3’
GroES_h_tADH1_R 5’CTTATTTAATAATAAAAATCATAAATCATAAGAAATTCGCTTAAGCTTCAACGATAGCCA3’
pPGK_F 5’TACTGTAATTGCTTTTAGTT3’
pPGK_R 5’TGTTTTATATTTGTTGTAAA3’
tPGK_F 5’ATTGAATTGAATTGAAATCG3’
tPGK_h_URA3_R 5’TGGACCATAACTTCGTATAATGTATGCTATACGAAGTTATAAGGCATTAAAAGAGGAGCG3’
pADH1_h_URA3_F 5’ATTTCTATAACTTCGTATAGCATACATTATACGAAGTTATTTCCGGGTGTACAATATGGA3’
pADH1_R 5’TGTATATGAGATAGTTGATTGTATG3’
tADH1_F 5’GCGAATTTCTTATGATTTAT3’
tADH1_R 5’TACAATTGGGTGAAATGGGG3’
URA3loxP_F 5’ATAACTTCGTATAGCATACA3’
URA3loxP_R 5’ATAACTTCGTATAATGTATG3’
URA3_GRE3Δ_F 5’ATATAGAAGCAAATAGTTGTCAGTGCAATCCTTCAAGACGATCACTATAGGGCGAATTGG3’
URA3_GRE3Δ_R 5’GTAAAAATTTATACACATATACAGCATCGGAATGAGGGAAATCTCAAGCTATGCATCCAA3’
Cen2_F 5’TTCAAACTAGGAGTTTGTTGA3’
Cen2_R 5’AAGCTTTCTATTAGTCATTCTTC3’
Check_Cen2_F 5’TGAGACGATTTAGAGTAAGGT3’
Check_Cen2_R 5’GGTGACGACGATATACAG3’
Check_ΔGRE3_F 5’AGCCACATGCGGAAGAAT3’
Check_ΔGRE3_R 5’AAGCGTGGATGACACCAC3’