Skip to main content

Table 2 Primers used in this study

From: High-specificity synthesis of novel monomers by remodeled alcohol hydroxylase

Name Sequence (5′ → 3′)
BM3-NcoF CTTGCCATGGGCATGACAATTAAAGAAATGCCTCAG
BM3-BamR CGGGATCCTTACCCAGCCCACACGTCTTTTG
BM3J-NcoF CATGCCATGGGCATGACAATTAAAGAAATGCCTCAG
BM3J-EcoR GACGGAATTCTTCCACATCG
BM3J-EcoF GAAGAATTCCGTCCAGAGCGTTTTG
BM3J-NotR ATAAGAATGCGGCCGCTTACCCAGCCCACACGTCTTTTG
BM3-V78A-F GCTTAAATTTGCACGTGATTTTGCAGGAGACGG
BM3-V78A-R CAAAATCACGTGCAAATTTAAGCGCTTGACTTAAG
BM3-T175I-F CCATTTATTATCAGTATGGTCCGTGCACTGGATG
BM3-T175I-R GACCATACTGATAATAAATGGATGAGGCTGATC
BM3-A184V-F GGATGAAGTAATGAACAAGCTGCAGCGAGC
BM3-A184V-R CTTGTTCATTACTTCATCCAGTGCACGGACC
BM3-F205C-F CAAGCGCCAGTGTCAAGAAGATATCAAGGTG
BM3-F205C-R CTTCTTGACACTGGCGCTTGTTTTCATCATAAG
BM3-S226R-F CGCAAAGCACGCGGTGAACAAAGCGATG
BM3-S226R-R GTTCACCGCGTGCTTTGCGATCTGC
BM3-H236Q-F CGCAGATGCTAAACGGAAAAGATCCAG
BM3-H236Q-R CCGTTTAGCATCTGCGTTAATAAATCATC
BM3-E252G-F GATGACGGGAACATTCGCTATCAAATTATTAC
BM3-E252G-R GCGAATGTTCCCGTCATCAAGCGGCTCACCCG
BM3-R255S-F GACGAGAACATTAGCTATCAAATTATTACATTC
BM3-R255S-R GATAGCTAATGTTCTCGTCATCAAGCGGCTCAC
BM3-A290V-F GTATTACAAAAAGTAGCAGAAGAAGCAGC
BM3-A290V-R CTTCTGCTACTTTTTGTAATACATGTGG
BM3-L353V-F GCGACGAAGTAATGGTTCTGATTCCTCAGC
BM3-L353V-R GAACCATTACTTCGTCGCCTTTTTCTAAAGG
BM3J-A78F-F GCGCTGAAATTTTTCCGTGATTTTGCAGGTGACGG
BM3J-A78F-R CAAAATCACGGAAAAATTTCAGCGCTTGACTTAAG
J2-R47L-F GCGCCTGGTCTGGTAACGCGCTACTTATCAAG
J2-R47L-R CGCGTTACCAGACCAGGCGCCTCGAATTTAAAG
J2-F87A-F GACGGGTTGGCTACAAGCTGGACGCATG
J2-F87A-R GCTTGTAGCCAACCCGTCACCTGCAAAATC
  1. Underlines indicate restriction enzyme sites