Skip to main content

Table 4 PCR primers designed for plasmids construction

From: Metabolic engineering of Escherichia coli for the production of hydroxy fatty acids from glucose

Oligonucleotide primers Sequences
‘tesA_ F_NdeI GGAATTCCATATGGCGGACACGTTATTGATTCTGGG
‘tesA_R_BglII GAAGATCTTATGAGTCATGATTTACTAAAGGC
A1_ F_NcoI CATGCCATGGGCATGACAATTAAAGAAATGCCTCAG
A1_ R_EcoRI CCGGAATTCTTACCCAGCCCACACGTCTTTTG
T7'tesA_F_EcoRI CCGGAATTCTAATACGACTCACTATAGGGG
T7′tesA_R_XhoI CCGCTCGAGTTATGAGTCATGATTTACTAAAGGC