Skip to main content

Table 2 Primers used in the analysis of PT1-CHO cell lines

From: Mechanisms underlying epigenetic and transcriptional heterogeneity in Chinese hamster ovary (CHO) cell lines

Primer designation Type of analysis Primer sequence (5′-3′) Amplicon size (bp)
PTl-HC-Fwd qRT-PCR GTGAAGGGCCGATTCACTAT 179
PTl-HC-Rev TTGGCTGAGGAGACTGTGAC
PTl-LC-Fwd qRT-PCR GGCACACGGTATTCTCTCAA 192
PTl-LC-Rev TGAGGCACCTCCAGATGTTA
PTl-LC-Fwd-2 qPCR ACCAACCGTATCCATCTTCC 125
PTl-LC-Rev-2 AACTGTTCAGGACGCCATT
Vezt_305_up qPCR TGAACTTGAAAGCTCGTTTG 134
Vezt_305_dw CTCCGGAGCAGTTTTATCCAC
EEF1A1-B5-Fwd Bisulfite sequencing TTGTTGTAGGGAGTTTAAAATGGAG 231
EEFlAl-BS-Rev TCCACCCACTCAATATAAAAAAACT
EEF1A1-Nuc853-Fwd ChIP, FAIRE AGTTGCGTGAGCGGAAAGAT 111
EEF1A1-Nuc853-Rev CCTTTGTGTGGGTGACT
EEF1A1-Nucl008-Fwd ChIP, FAIRE GATTAGTTCTCGAGCTTTTGGAGT 102
EEF1A1-Nucl008-Rev CCTAACTTCAGTCTCCACCCACT
EEF1A1-Nuc853-1008-Fwd ChIP, FAIRE GTGAGTCACCCACACAAAGG 107
EEF1A1-Nuc853-1008-Rev GCTCGAGAACTAATCGAGGTG
EEF1A1-Nucl008 right-Fwd ChIP, FAIRE CACACTGAGTGGGTGGAGAC 107
EEFlAl-NuclOOS right-Rev TGAGGCTTGAGAATGAACCA