Skip to main content

Advertisement

Table 2 List of the primers and probes of the 14 potential marker genes used in the RT-qPCR analysis

From: Transcriptome study and identification of potential marker genes related to the stable expression of recombinant proteins in CHO clones

Gene Symbol Forward Primer (5′ → 3′) Reverse Primer (5′ → 3′) Probe (5′ → 3′)
Fgfr2 GCCTGAGTTACACATCCATCACA GATGATGAAGGTCCTGAAGCTGTTA TTGGCCTCACATCTCC
BX842664.2/ Hist1h3c GGCCCAGACATGGACACT CCATGAGGCACTGGGACTTT AAGCGCCCCATCAGC
AC115880.11 CGAGCTTTTCACCAGTAGAGATAGTTA TTGACACATACAGCTCCAATTCCA ACGGGCTTCAGTCTTC
E130203B14 CCAGTGGGTACATCACATGAGAGA CCCGAGTGGGAGCTGACT AAACTGTGCCAAACTC
hDhfr ATATGGGGATTGGCAAGAACG CATTCTTTGGAAGTACTTGAACTCGTT AGACCTACCCTGGCCT
Hist1h2bc ACGAGGAGTAGACCTGATGATGT GTATCACCTATTTCCATTGTCTCAATTGC CAGTGCTGGACGTTGTT
Cspg4 GCCATGTGGCCTAGCTTCAT AAACAGGTGAGAATAGAGGACTTTGG CAAGCTCTTGAATTCC
C1qtnf1 CATTCCACAGACACTGGATGGA GCCAAAGAAGCCAGGACTGA CTGACCCCATCATCCC
Foxp2 GGGCTTACGGCTTATACTCTATGTG CCCAGTTAGTGGTAATTCTATCAAGTACTTT ACGGTGCCATGAATCC
Mmp10 CAGGAATCGAGCCACAAATTGATG TCAAACTGTGATGATCCATGGAAGAA AATGCCTGCAACACCG
Vsnl1 ACCCTTAAGCATATGTCTTTGGAATTTGA TTCCGAAATGAACAAATCGTCTGTT TCATCCAGCCCCTCCC
CU459186.1 GGGAGGCCGGTTTTGG TTGTGCAACACCCAGAGACTAC TTGCTGCCCGGTATCC
Egr1 GCTCACCTCTGGCCTTAAAGG CATTCTGGAGAACCAAAGCT CAGCTCAGCCCTCTTC
Ptpre CCCTCCAGTCTCTTGGCTAATG GCAAACTGAGTCTCTGTGTCTTAGG CCACAACCAAATTCAG
  1. All of the primers and probes were designed as TaqMan Gene Expression Assays labelled with FAM (3′) and MGB (5′)