Skip to main content

Table 1 Primer sequences in this study

From: Cloning and characterization of the pepper CaPAO gene for defense responses to salt-induced leaf senescence

primer Sequence (5′-3′)
Cloning of CaPAO gene
 EST-CaPAOF CTTCACTCCCAATCACCAAACC
 EST-CaPAOR TCGCTAACGAGCCCAAGATAAT
 5′RACE-CaPAOGSP CGGAGACTGAAACGCTTTAGCTTC
 5′RACE-CaPAONGSP GAACAACCCACTGAGACCCAGATTT
 3′RACE-CaPAOGSP TTGGTGGCAGGTTTTTCCGAGAT
 3′RACE-CaPAONGSP CGGCAGCACAGACAACCAACCAC
quantitative real-time PCR
 RT-CaPAOF CAAGTTTGCCTACACCATTTCAG
 RT-CaPAOR GCCCATTTTCATCTAATCTCCCT
CaUBI3F TGTCCATCTGCTCTCTGTTG
CaUBI3R CACCCCAAGCACAATAAGAC
Virus-induced gene silencing (VIGS) vector construction
 TRV-CaPAOF CAATGGCACCAGGAAAGACC
 TRV-CaPAOR GCGTTTGGACAAGACGGTAG
CaPDSF TGTTGTCAAAACTCCAAGGTCTGTA
CaPDSR TTTCTCCCACTTGGTTCACTCTTGT
Tabacco genetic transformation
 2307-CaPAOF ATGGCTTCTTCTTCTTCTTGTAT
 2307-CaPAOR TTCTAAATTTCCCTAGACTTCTAGTC
 RD29A-F GAATAAATATCATACCGACATCA
CaPAO-R CAGTACTAGTAGATGATTCTTGTTC
NtUBIF TCCAGAAAGAGTCAACCCG
NtUBIR GACCTCAGTAGACAAAGCACAT