Skip to main content

Table 2 List of primers

From: Gene stacking in plant cell using recombinases for gene integration and nucleases for marker gene deletion

Primers Sequence (5′ → 3′)
a (or a2) TCTACTTCTGTTCATGTTTGTG
a1 TCTAACCTTGAGTACCTATCTATTA
b AAGACCCCAACGAGAAGC
c CTCGATGCGATGTTTCGCTT
d CTAATCGCCATCTTCCAGCA
e ACAGGCTGAACTTGTGGC
f GATGGATTGCACGCAGGTTC
g GCCACAAGTTCAGCGTGT
ISceI Foward GCTGTCTCCTCCTCACAAG
ISceI Reverse GGGTCAGGTAGTTCTCCACC
ZFN Reverse TGCAGATTCCGACACTGGAAG
Chr 10 locus1 Forward GCAAGCCGGTCACCATTTTCA
Chr 10 locus1 Reverse TTCGTTGGTTTGCACGCTAT
Chr 10 locus2 Forward GAAAGGCGTAACGATCTGGG
Chr 10 locus2 Forward TAGTACGAGAGGACCGGGAA