Skip to main content

Table 1 Primers used in this study for PCR

From: High-level expression of human arginase I in Pichia pastoris and its immobilization on chitosan to produce L-ornithine

Primers Sequence (5′ → 3′)  
arg-1 GTCAATGAGTGCTAAGTCCAGAACGATTG  
arg-2 ATGAGTGCTAAGTCCAGAACGATTG  
arg-3 CTTAGAAAATGGAGCACCAATAATACCAATCGTTCTGGACTTAGCACTC  
arg-4 GTATTATTGGTGCTCCATTTTCTAAGGGACAACCAAGAGGTGGTGTCGA  
arg-5 CCAGCCTTTCTCAAAACTGTTGGACCTTCTTCGACACCACCTCTTGGTT  
arg-6 AACAGTTTTGAGAAAGGCTGGTCTACTTGAAAAGTTGAAAGAACAAGAA  
arg-7 ATCACCGTAATCCTTAACATCACATTCTTGTTCTTTCAACTTTTCAAGT  
arg-8 GTGATGTTAAGGATTACGGTGATTTGCCATTTGCTGATATCCCAAACGA  
arg-9 GGATTCTTCACAATTTGGAATGGAGAATCGTTTGGGATATCAGCAAATG  
arg-10 CCATTCCAAATTGTGAAGAATCCAAGATCTGTGGGAAAAGCCTCTGAAC  
arg-11 CTTAACTTCAGCAACTTTACCAGCCAGCTGTTCAGAGGCTTTTCCCACA  
arg-12 GCTGGTAAAGTTGCTGAAGTTAAGAAGAACGGTAGAATTTCTCTTGTTT  
arg-13 TAGCCAAAGAATGATCACCACCCAAAACAAGAGAAATTCTACCGTTCTT  
arg-14 GGTGGTGATCATTCTTTGGCTATTGGTTCTATTTCAGGACATGCTAGAG  
arg-15 CAAATAACACCCAAGTCTGGATGAACTCTAGCATGTCCTGAAATAGAAC  
arg-16 CATCCAGACTTGGGTGTTATTTGGGTTGATGCTCATACTGACATTAACA  
arg-17 TACCAGAAGTAGTAGTCAGTGGAGTGTTAATGTCAGTATGAGCATCAAC  
arg-18 TCCACTGACTACTACTTCTGGTAACTTGCATGGTCAACCAGTTTCTTTT  
arg-19 AATCTTACCCTTCAATTCCTTCAACAAAAAAGAAACTGGTTGACCATGC  
arg-20 GTTGAAGGAATTGAAGGGTAAGATTCCAGATGTTCCAGGTTTTTCTTGG  
arg-21 ATCCTTAGCAGATATACATGGAGTAACCCAAGAAAAACCTGGAACATCT  
arg-22 TACTCCATGTATATCTGCTAAGGATATTGTTTACATCGGTTTGAGAGAT  
arg-23 AGATGTAATGTTCACCTGGATCAACATCTCTCAAACCGATGTAAACAAT  
arg-24 TGATCCAGGTGAACATTACATCTTGAAGACTTTGGGTATTAAGTACTTT  
arg-25 AACCTATCAACTTCGGTCATAGAAAAGTACTTAATACCCAAAGTCTTCA  
arg-26 TCTATGACCGAAGTTGATAGGTTGGGAATTGGCAAGGTTATGGAAGAAA  
arg-27 CTTTCTACCCAACAAGTAAGACAATGTTTCTTCCATAACCTTGCCAATT  
arg-28 ATTGTCTTACTTGTTGGGTAGAAAGAAGAGACCAATCCATTTGTCTTTT  
arg-29 AAGATGGGTCCAAACCATCAACGTCAAAAGACAAATGGATTGGTCTCTT  
arg-30 TTGATGGTTTGGACCCATCTTTCACTCCAGCTACTGGTACTCCAGTTGT  
arg-31 CAAACCCTCTCTGTACGTTAGACCACCAACAACTGGAGTACCAGTAGCT  
arg-32 TCTAACGTACAGAGAGGGTTTGTACATTACTGAGGAGATTTACAAAACA  
arg-33 ATATCCAAGCCAGACAACAAACCTGTTTTGTAAATCTCCTCAGTAATGT  
arg-34 GTTTGTTGTCTGGCTTGGATATTATGGAGGTTAATCCATCCTTGGGCAA  
arg-35 TACCGTACGAGTAACTTCTTCTGGAGTCTTGCCCAAGGATGGATTAACC  
arg-36 CAGAAGAAGTTACTCGTACGGTAAACACTGCCGTTGCAATTACATTAGC  
arg-37 GTTACCTTCACGAGCTAAACCGAAGCAAGCTAATGTAATTGCAACGGCA  
arg-38 CGGTTTAGCTCGTGAAGGTAACCATAAACCAATTGACTATTTGAACCCA  
arg-39 CACAATTTTAATGATGATGATGATGGTGCTTTGGTGGGTTCAAATAGTCAATTGGTTTA  
arg-40 GGCCATTAATGATGATGATGATGGGTGCTTTGGTGGGTTCAAATAGTCAATTGGTTTA