Skip to main content

Table 4 Primers used in this study

From: Comparison of mcl-Poly(3-hydroxyalkanoates) synthesis by different Pseudomonas putida strains from crude glycerol: citrate accumulates at high titer under PHA-producing conditions

Primer Sequence (5′-3′)
PP5004_UP fw TCTAGAGACATCCTGTTCTGGAAC
PP5004_UP_rev CCCCTGTCAGGCCGCAGCTGGCACGTGACTCTTGGGTGAAGTAAAC
PP5004_DOWN_fw CACCCAAGAGTCACGTGCCAGCTGCGGCCTGACAGGGGAAATGGATC
PP5004_DOWN rev GGTACCGTTGAACAGCTCCTTGAC