Skip to main content

Table 1 List of primers used in the study

From: Molecular characterization of two A-type P450s, WsCYP98A and WsCYP76A from Withania somnifera (L.) Dunal: expression analysis and withanolide accumulation in response to exogenous elicitations

Primers Sequence (5′ − 3′) Direction
Degenerate
CYP450-1 F. CCN(A/C/G/T)TAY(C/T)GGH(A/C/T)GD(G/A/T)TACTGGAGR(A/G)CAG Forward
CYP450-1R. AGTCD(G/A/T)GD(G/A/T)CAW(A/T)D(G/A/T)GCCCATTCD(G/A/T)AG Reverse
CYP450-2 F. ATATGGGCY(C/T)GATTATGGV(G/A/C)CCTCA Forward
CYP450-2R. AGCATH(A/C/T)AGH(A/C/T)GGAGTTGGAGGY(C/T)TG Reverse
5′ and 3′ RACE
5′ Adapter* GCUGAUGGCGAUGAAUGAACACUGCGUUUGCUGGCUUUGAUGAAA  
5′ RACE-OUT* GCTGATGGCGATGAATGAACACTG Forward
5′ RACE-IN* CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG Forward
5′ CYP98-OUT TGTTATCAGAATTATTGCAATCTCTGT Reverse
5′ CYP98-IN AGCCGTAACCTCATCTTCACGAATGG Reverse
5′ CYP76-OUT CGTCTCTGTACCAGCTAAAAACATTTCCAC Reverse
5′ CYP76-IN GATCTCATGTTCTGATAACTTGGCTGGTT Reverse
3′ Adapter* GCGAGCACAGAATTAATACGACTCACTATAGGT12V(G/A/C)N(A/C/T/G)  
3′ RACE-OUT* GCGAGCACAGAATTAATACGACT Reverse
3′ RACE- IN* CGCGGATCCGAATTAATACGACTCACTATAGG Reverse
3′ CYP98-OUT TGATCGGCTATGAGCGCGTGATGAA Forward
3′ CYP98-IN AAGCGCTAAGGTTGCAGCCTCCAA Forward
3′ CYP76-OUT AGAGATCCTGAATGTTGGGATGACCCTAT Forward
3′ CYP76-IN AGAGATCCTGAATGTTGGGATGACCCTAT Forward
Full length   
FullCYP98F ATGGCAATTCCCTTAGCTGCTGCAATCCCTC Forward
FullCYP98R TTATATGTCCACTGCAATTCGTTTATACAACTCAGC Reverse
FullCYP76F ATGGAATGGGAATGGAGCTATTTGT Forward
FullCYP76R CTAGATAAGATTGATGAGTGTCTCA Reverse
Expression ( E. coli )
CYP98BamHIF CGGGATCCATGGCAATTCCCTTAGCTGCTGCAA Forward
CYP98SalIR GCTCGTCGACTTATATGTCCACTGCAATTCGT Reverse
CYP76BamHIF CGGGATCCATGGAATGGGAATGGAGCTATTTGT Forward
CYP76SalIR GCTCGTCGACCTAGATAAGATTGATGAGTGTCTCA Reverse
Real-Time analysis
RTCYP98F GTGATGGATGAACAAGGAAACGA Forward
RTCYP98R CCGTGCTTAGAAAATGCATCCTC Reverse
RTCYP76 F.P TAGAATGGGCACTAGCAGAGCTTTTGCG Forward
RTCYP76 R.P CTTGCATATAAGGGAGATTGTCGATGTCGTT Reverse
ActinF GAGAGTTTTGATGTCCCTGCCATG Forward
ActinR CAACGTCGCATTTCATGATGGAGT Reverse
  1. *Primers marked with star were provided with the kits. Added restriction sites for cloning into pGEX4T-2 vector are bold.