Skip to main content

Table 8 Primers used in this study

From: Generation of an external guide sequence library for a reverse genetic screen in Caenorhabditis elegans

Primer Sequence
FLEGSp 5'-pTCGATGACGGCAGATTTAGAGTCTGCTNNNTTTGGCTATAGTGAGTCGTATTAATTTCG-3'
RLEGSp 5'-pCTTCGAAGGTTCGAATCCTTCNNNNNNNACCATTTTAGCATAACCCCTTGGGGCCTCT-3'
FEGSp-Ngfp-lacZ 5'p-TCGATGACGGCAGATTTAGAGTCTGCTTTCTTTGGCTATAGTGAGTCGTATTAATTTCG-3'
REGSp-Ngfp-lacZ 5'p-CTTCGAAGGTTCGAATCCTTCTTTAAATACCATTTTAGCATAACCCCTTGGGGCCTCT-3'
FEGSp-Mtgfp 5'p-TCGATGACGGCAGATTTAGAGTCTGCTATCTTTGGCTATAGTGAGTCGTATTAATTTCG-3'
REGSp-Mtgfp 5'p-CTTCGAAGGTTCGAATCCTTCTATTAACACCATTTTAGCATAACCCCTTGGGGCCTCT-3'
FEGSp-Ngfp-lacZ-D 5'p-TCGATGACGGCAGATTTAGAGTCTGCTTTCTTTGGCTATAGTGAGTCGTATTAATTTCG-3'
REGSp-Ngfp-lacZ-D 5'p-CTTCGAAGGAAGGAATCCTTCTTTAAATACCATTTTAGCATAACCCCTTGGGGCCTCT-3'
FEGSp-Mtgfp-D 5'p-TCGATGACGGCAGATTTAGAGTCTGCTATCTTTGGCTATAGTGAGTCGTATTAATTTCG-3'
REGSp-Mtgfp-D 5'p-CTTCGAAGGAAGGAATCCTTCTATTAACACCATTTTAGCATAACCCCTTGGGGCCTCT-3'
FLEGSp-35-D 5'-pTCGATGACGGCAGATTTAGAGTCTGCTTCCTTTGGCTATAGTGAGTCGTATTAATTTCG-3'
RLEGSp-35-D 5'-pCTTCGAAGGAAGGAATCCTTCATGCGACACCATTTTAGCATAACCCCTTGGGGCCTCT-3'
FLEGSp-83-D 5'-pTCGATGACGGCAGATTTAGAGTCTGCTTTGTTTGGCTATAGTGAGTCGTATTAATTTCG-3'
RLEGSp-83-D 5'-pCTTCGAAGGAAGGAATCCTTCTATGTTCACCATTTTAGCATAACCCCTTGGGGCCTCT-3'
Fclone-IVTT 5'-AAATGGTNNNNNNNGAAG-3'
Rclone -IVTT 5'-AGATTGTGCACCGCCGCT-3'
FNgfp-lacZ-IVTT 5'-AAATGGTATTTAAAGAAGGA-3'
RNgfp-lacZ-IVTT 5'-AGATTGTGCACCGCCGCT-3'
FMtgfp-IVTT 5'-AAATGGTGTTAATAGAAGGA-3'
RMtgfp-IVTT 5'-AGATTGTGCACCGCCGCT-3'
F35-IVTT 5'-AAATGGTGTCGCATGAAG-3'
R35 -IVTT 5'-AGATTGTGCACCGCCGCT-3'
F83-IVTT 5'-AAATGGTGAACATAGAAG-3'
R83 -IVTT 5'-AGATTGTGCACCGCCGCT-3'
eft-2-QPCR-F 5'-GACGAGAAGGATTTGGAAGGAA-3'
eft-2-QPCR-R 5'-ACTGGGGATGGAAGATGGAA-3'
GFP-QPCR-F 5'-TGGAGTTGTCCCAATTCTTGTT-3'
GFP-QPCR-R 5'-GCATCACCTTCACCCTCTCC-3'
S-EGS-F 5'-TTAGAGCTTGACGGGGAAAG-3'
S-EGS-R 5'-CCTGCCACCATACCCACGCC-3'
  1. The "p" in the "sequence" column represents the modification by phosphorylation. Fclone-IVTT is the outline of the corresponding primer used in the specific experiment. Base-substitution mutations at three positions of the T-loop are indicated by bold text.