Skip to main content

Table 1 Streptococcus pneumoniae NASBA primers used in current experiment

From: Fluorescent labeling of NASBA amplified tmRNA molecules for microarray applications

Primer Sequence 5'-> 3'
Forward +T7 AATTCTAATACGACTCACTATAGGGAGAAGGTTCGACAGGCATTATGAGGCATA
Reverse CGTCCAAACACCTGCCAACATA