Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Homologous recombination-mediated cloning and manipulation of genomic DNA regions using Gateway and recombineering systems

Primer name Sequence 5'-3'
Tc-5'-PmlNco CACGTGCCATGGTTCTCATGTTTGACAGCTTATC
Tc-3'-PmlNsi CACGTGAT GCATGGACTTCCGCGTTTCCAG
SpR-5'-HpaBspNhe ATCGTTAACTCATGAGCTAGCCGTTCGTGAATACATGTTATAATA
SpR-3'-Hpa ATCGTTAACTTATTTGCCGACTACCTTGGTGATCT
GFP-mu-5'-Bam ATCGGATCCAAAACAATGGCTAGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCC
GFP-mu-3'-NotAvrBgl GATATCGCGGCCGCCCTAGGTAGATCTTCCACCTCCACCTTTGTATAGTTCATCCATGCCATGTGTA
ABI3-5'-CDS-Rescue-3'-Test CTCCTCCATGGTCATCTAACC
ABI3-3'-CDS-Rescue-5'-Test GTACCCGAGTGTGCCACTTC
PAP85-Prom-Rescue-3'-Test ACTTCCTAGGGTTGCTACTG
PAP85-Term-Rescue-5'-Test ACCGGATGGTTTGGT TATGG
ABI3-L1-Rescue-5'-CDS1 agatctccggcgttggccgccacatgcaagcttttcatcgttgaagtggaCAAATACGCATACTGTTATCTGGCT
ABI3-L2-Rescue-3'-CDS1 tattacatatgtggctcatttcttgagtcgagcttacatatcgtttataaAACCTGATGTTCTGGGGAATATAG
ENTRY-L1 TTAGTTAGTTACTTAAGCTCGG
ENTRY-L2 TGAGACACGGGCCAGAGC
PAP85-Rescue-5'-Prom2 ttcctaccaccatgaccaaacttggaatcccgaaactccctcttcttgttTTGTCGTTTCCCGCCTTCAG
PAP85-Rescue-3'-Term2 atagctcgtattttttagcttatgtctaaaatacccctgagatcatgtggAACGTTCTCGAGGGGATCTTCTG
pCB-RB CTGTGGTTGGCATGCACATA
tCUP2-Out CGAGGTTAGACCTTCAGGAAATA
PAP85-Integ-Dest-5'3 acccattattgtcctcaaaaacaaacacatcaacaaaacaacaagaaaaaGATATCACAAGTTTGTACAAAAAAGC
PAP85-Integ-Dest-3'3 ttaaactcttaaactctttcctttcttaggactgtaaaaaagcattttcaGATATCACCACTTTGTACAAGAAAGC
PAP85-Dest-Integ-5'-Test TGATGCGTACGAACACTC
Cm-5'-AS ACGGTGGTATATCCAGTGATT
PAP85-Dest-Integ-3'-Test GTTACATGCAGAGCG TTACC
C1 TTATACGCAAGGCGACAAGG
PAP85-S1 GCAGGGATCCT TGTTCCTTC
  1. 1Upper-case letters correspond to unique recognition sequences in pJM1 and lower-case letters correspond to 50 bp regions homologous to ABI3.
  2. 2Upper-case letters correspond to unique recognition sequences in pWY109 and pWY107 and lower-case letters correspond to 50 bp regions homologous to PAP85.
  3. 3Upper-case letters correspond to unique recognition sequences in the RfA-Destination cassette of pMW138-1 and lower-case letters correspond to 50 bp regions homologous to PAP85.