Skip to main content

Table 2 Primers used for DHPLC and mismatch-specific endonuclease cleavage analysis of the HBB gene

From: Comparison of the mismatch-specific endonuclease method and denaturing high-performance liquid chromatography for the identification of HBB gene mutations

Primer Name Sequence (5'-3') PCR Length (bp) Anneal Tm (°C) DHPLC Tm (°C) DHPLC %B
Start/end
5'-Label
B1 gacaggtacggctgtcatca 337 56 61 55–64 4.5 min FAM
B2 gtctccacatgcccagtttc      HEX
B3 gaaactgggcatgtggagac 287 56 61 55–64 4.5 min FAM
B4 agcttgtcacagtgcagctc      HEX
Y3 gtgtacacatattgaccaaa 423 56 56 56–65 4.5 min FAM
Y4 agcacacagaccagcacgt      HEX