Comparison of the mismatch-specific endonuclease method and denaturing high-performance liquid chromatography for the identification of HBB gene mutations

Table 2 Primers used for DHPLC and mismatch-specific endonuclease cleavage analysis of the HBB gene

Primer Name	Sequence (5'-3')	PCR Length (bp)	Anneal Tm (°C)	DHPLC Tm (°C)	DHPLC %B Start/end	5'-Label
B1	gacaggtacggctgtcatca	337	56	61	55–64 4.5 min	FAM
B2	gtctccacatgcccagtttc					HEX
B3	gaaactgggcatgtggagac	287	56	61	55–64 4.5 min	FAM
B4	agcttgtcacagtgcagctc					HEX
Y3	gtgtacacatattgaccaaa	423	56	56	56–65 4.5 min	FAM
Y4	agcacacagaccagcacgt					HEX

ISSN: 1472-6750