Skip to main content

Table 1 Primer sequences

From: Scarless and site-directed mutagenesis in Salmonella enteritidischromosome

Primer Amplified region Primer sequence
lam-up-f loop 9 up 5'TGTACAAGTGGACGCCAATC 3'
lam-up-r   5'GTTATCGCCGTCTTTGATATAGCC 3'
lam-dn-f loop 9 dn 5'ATTTCCCGTTATGCCGCAGC 3'
lam-dn-r   5'GTTAAACAGAGGGCGACGAG 3'
Km-f I-SceI/Kmr gene 5'GCTATATCAAAGACGGCGATAAC TAACTATAACGGTCCTAAGGTAGCGAATTTCCGGGGATCCGTCGA 3'
Km-r   5'GCTGCGGCATAACGGGAAAT TGTAGGCTGGAGCTGCTTCG 3'
Kan4f inside Kmr gene: sequencing 5'CAAAAGCGCTCTGAAGTTCC 3'
Kan4r   5'GCGTGAGGGGATCTTGAAGT 3'
lam-i1 M2e/loop 9 dn 5'GCTATATCAAAGACGGCGATAAC GAAGTTGAAACCCCGATTCGTAAC ATTTCC CGTTATGCCGCAGCG 3'
lam-i2 CD154s/loop 9 dn 5'GCTATATCAAAGACGGCGATAAC TGGGCAGAAAAAGGTTATTATACCATGTCT ATTTCCCGTTATGCCGCAGC 3'
i2-i1h-f CD154s-(Gly)3-LM2-(Gly)3-loop 9 dn 5'TGGGCAGAAAAAGGTTATTATACCATGTCTGGTGGTGGTGAAGTTGAAACCCCGATTCGTAACGGTGGTGGT ATTTCCCGTTATGCCGCAGC 3'
i2-i1-r CD154s-(Gly)3-loop 9 Up 5'AGACATGGTATAATAACCTTTTTCTGCCCAACCACCACC GTTATCGCCGTCTT TGATATAGCC 3'
TJ1-f CD154-(Ser)4-LM2-(Ser)4-LM2-(Ser)4-loop 9 dn 5'TGGGCAGAAAAAGGTTATTATACCATGTCTTCCTCCTCCTCCGAAGTTGAAACCCCGATTCGTAACTCCTCCTCCTCCGAAGTTGAAACCCCGATTCGTAACTCCTCCTCCTCC ATTTCCCGTTATGCCGCAGC 3'
TJ1-r CD154-(Ser)4-M2eA-(Ser)4-M2eA-(Ser)4-loop 9 up 5'AGACATGGTATAATAACCTTTTTCTGCCCAGGAGGAGGAGGAGTTACGGGTCGGGGTTTCAACTTCGGAGGAGGAGGAGTTACGGGTCGGGGTTTCAACTTCGGAGGAGGAGGA GTTATCGCCGTCTTTGATATAGCC 3'
lam 3f outer regions of loop 9: sequencing 5'GCCATCTCGCTTGGTGATAA 3'
lam 3r   5'CGCTGGTATTTTGCGGTACA 3'
aroA-1F aroA up 5'CTGGACGTCTCTCGCTATGG 3'
aroA-1R   5'TAGGAACTTCGAAGCAGCTCCAGCCTACACATAAAAACC CCACAGACTGG 3'
aroA-2F aroA dn 5'GGAATAGGAACTAAGGAGGATATTCATATGGTCTTCTGTTGCGCCAGT 3'
aroA-2R   5'CTTGCGAGAGTGCCCTAAAG 3'
htrA-1F htrA up 5'GGTTTTAGCCGCCTGCTT 3'
htrA-1R   5'TAGGAACTTCGAAGCAGCTCCAGCCTACACTTGCTGTGTACGTCAGATTCA 3'
htrA-2F htrA dn 5'GGAATAGGAACTAAGGAGGATATTCATATGTCACCTTTGTCCCCCTTC 3'
htrA-2R   5'GCATCATTTCGGCAGTCATA 3'
Kan 3F Kmr gene 5'GTGTAGGCTGGAGCTGCTTC 3'
Kan 3R   5'CATATGAATATCCTCCTTAG 3'
  1. Italicized nucleotides are those which have complementation to either side of the lamB gene loop 9 insertion site, which corresponds to nucleotide 1257 using S. typhimurium as an annotated reference genome. Bold font nucleotides represent the I-SceI site in the Km-f primer, and underlined sequences are all other insert sequences.