Skip to main content

Table 1 Primers used for the amplification of the HPV-11 L1 and L1 NLS- ORFs

From: Expression of HPV-11 L1 protein in transgenic Arabidopsis thaliana and Nicotiana tabacum

Primer Pair Construct Primers
1 pHPL51 (502) Forward 5'- GGAATTCCGGAGGAATTTTTTACAGATGTGGCGGC -3'
   Reverse 5'- GACGCCGTCGACTCCGGAACTGACACACATATATTAG -3'
2 pHPS51 (ΔC481) Forward 5'- GGAATTCCGGAGGAATTTTTTACAGATGTGGCGGC -3'
   Reverse 5'- ACGCCGTCGACTCCGGATTATATACCTGTTACGAGCAGC -3'
3 pART27 L1 Forward 5'- ATGTGGCGGCCTAGCGAC -3'
   Reverse 5'- TTACTTTTTGGTTTTGGTACGTTTTCG-3'
4 pART27 L1 NLS- Forward 5'- ATGTGGCGGCCTAGCGAC -3'
   Reverse 5'- TTATATACCTGTACGAGCAGACG -3'
5 HPV-11 L1 NLS- internal Forward 5'- TGATACAGGCTTTGGTGC -3'
   Reverse 5'- TGGCTCATTGGTGTCTTC -3'
  1. GAATTC: EcoRI; TCCGGA: MroI, GTCGAC: SalI, ATG = start codon, TAA = stop codon