Skip to main content

Table 1 Synthesized oligonucleotides used in this study

From: Characterisation and application of a bovine U6 promoter for expression of short hairpin RNAs

Name Sequence
LL16 5'-CCAGCAAAGCAACCGATTC-3'
TD66 5'-GGCCATGCTAATCTTCTCTG-3'
TD72 5'-TTTTAGTATATGTGCTGCCG-3'
LL23 5'-ATCTCTCTTGAAGATGAACTTCAGGGTCAGCGGTTTGCCTTTCGTCCACGG-3'
LL13 5'-TCTAGATTCCAAAAAAGCTGACCCTGAAGTTCATCTCTCTTGAAGATG-3'
TD134 5'-TCTAGATTCCAAAAAAGCTGACCCTGAAGTTCATCTCTCTTGAAGATGAACTTCAGGG
TCAGCCAAACAAGGCTTTCTCCA-3'
LL31 5'-TCTAGATTCCAAAAAAAGCGCAGTGTTACTCCACTTCTCTTGAAAGTGGAGTAACACT
GCGCTGGTTTGCCTTTCGTCCACGG-3'
LBG-as1 5'-AAGTTCAACGGCACAGTCAAGCCTGTCTC-3'
LBG-s2 5'-AACTTGACTGTGCCGTTGAACCCTGTCTC-3'
LBG-as3 5'-AAGGTCATCCATGACCACTTTCCTGTCTC-3'
LBG-s4 5'-AAAAAGTGGTCATGGATGACCCCTGTCTC-3'
LBG-as5 5'-AAGCTCATTTCCTGGTACGACCCTGTCTC-3'
LBG-s6 5'-AAGTCGTACCAGGAAATGAGCCCTGTCTC-3'
LL05 5'- TCTAGATTCCAAAAAAGTTCAACGGCACAGTCAAGTCTCTTGAACTTGACTGTGCCGT
TGAACGGTTTGCCTTTCGTCCACGG-3'
LL06 5'-TCTAGATTCCAAAAAAGTTCAACGGCACAGTCAAGTCTCTTGAACTTGACTGTGCCGTT
GAACCAAACAAGGCTTTCTCCA-3'
BovineGpdhF 5'-AACGACCACTTTGTCAAGCTCAT-3'
BovineGpdhR 5'-TCCACCACCCTGTTGCTGTA-3'
BovineGpdhPROBE 5'-TCCTGGTACGACAATGA-3'
LL91 5'-RGRAURGRARARCUURCRARGRGRGURCRARGRC-3'
  1. 'r' prefix to G, A and C represents ribonucleotide, and U indicates ribo-uridine.