Skip to main content
Figure 1 | BMC Biotechnology

Figure 1

From: The defH9-iaaM auxin-synthesizing gene increases plant fecundity and fruit production in strawberry and raspberry

Figure 1

Southern blot analysis of strawberry and raspberry plants transgenic for DefH9-iaaM. Genomic DNA digested with HindIII from: F. vesca control plants (panel a, lane1), and transgenic lines 1 and 2 (panel a, lanes 2, 3 respectively); F. x ananassa control plants (panel b, lane1) and transgenic line 1 (panel b, lane 2); R. idaeus control plants (panel c, lane 1) and transgenic line 1 (panel c, lane 2). The blots were probed with a 589 bp DNA fragment of the iaaM coding region that does not contain the HindIII site present in the iaaM coding region. The probe was obtained by PCR using the following primers 5'AAACAAGCTTCCCACCACCATCCAG3' and 5'CATGCTCTTTTCACCCGTATTAG3'.

Back to article page

BMC Biotechnology

ISSN: 1472-6750

Contact us