Skip to main content

Table 3 Primers used in this study

From: Transgene autoexcision in switchgrass pollen mediated by the Bxb1 recombinase

Primer ID Gene/element Sequence (5′- 3′) Reference
b1 bar GCACCATCGTCAACCACTACATCG [7]
b2 TCATGCCAGTTCCCGTGCTTG [7]
h1 hptII (pMBXS640) TGATCGAAAAGTTCGACAGCGTCTC This study
h2 CTCCAGTCAATGACCGCTGTTATGC This study
h3 hptII (pGPro8) CTCCCGATTCCGGAAGTGCT This study
h4 CATCGCCTCGCTCCAGTCAA This study
r1 bxb1 CTGGTAGTCATCCGCCTGT This study
r2 CTTCTAATTCCATCTGCGCCAC This study
r3 bxbNom CAACTGGAGAGCTGCCAACAAC This study
r4 ATATCCCAGCATGGCTTCGG This study
g1 gusAeGFP AGCGCGTTACAAGAAAGC This study
g2 AGAGATAACCTTCACCCGG This study
g3 GUSPlus CGCAACCATATCGGATATGTCT This study
g4 TGACATTCGGAATCTCCACG This study
s1 Stuffer CTCGATCGGTTAGCATAGGCAG This study
s2 GACTTAGCGTAGCAATGGCAACTG This study
e1 Stuffer construct TGTAGTCTAGAGTGCTCCATTC This study
e2 CGGCTTCAAATGGCGTATAGC This study
e3 Autoexcision TCTAGAGTGCTCCATTCTCTCTCCTCG This study
e4 GTTAAAACTGCCTGGCACAGCAATT This study
c1 Excised DNA fragment GGGTTCCTATAGGGTTTCGCTCATG This study
c2 TGATTTACCAGAAGCGGAGGAAGAA This study
ActA actin CACTGGAATGGTCAAGGATG [7]
ActB CTCCATGTCATCCCAGTTG [7]