Skip to main content

Table 2 The Cricetulus griseus PAM gene sequence used for the RNAi and ZFN construction

From: Reduction in C-terminal amidated species of recombinant monoclonal antibodies by genetic modification of CHO cells

PAM gene nucleotide sequence GGGAGTGCTCCTAAGCCAGGCCAGTTCAGTGTTCCTCACAGTTTGGCCCTTGTGCCTCATTTGGACCAGTTGTGTGTGGCAGACAGGGAAAATGGCCGGATCCAATGTTTCAGAACTGACACCAAAGAATTTGTGAGAGAGATTAAACATGCGTCATTTGGGAGAAATGTATTCGCAATTTCATATATATCAGGTTTGCTCTTTGCAGTAAATGGGAAGCCTTACTTTGGAGACCATGAACCTGTGCAAGGCTTTGTGATGAACTTTTCCAGTGGGGAAATTATAGATGTCTTCAAGCCAGTACGCAAGCACTTTGACATGCCTCACGATGTGGTTGCCTCTGACGATGGGAATGTGTACATTGGAGACGCACACACGAACACGGTGTGGAAGTTCACCCTGACTGAAAAAATGGAGCATCGATCGGTTAAAAAGGCAGGCATTGAGGCTCAGGAAATCAAAGAAACCGAGGCAGTTGTTGAATCCAAAATGGAGAACAAACCCACCTCCTCAGAATTGCAGAAGATGCAAGAGAAACAGAAACTGATCAAAGAGCCAGGTTCGGGAGTGCCCGTGGTTCTCATTACAACCCTTCTGGTTATTCCTGTGGTTGTCCTGCTGGCCATTGTCATGTTTATTCGGTGGAAAAAATCAAGGGCCTTTGGAGGAAAA