Skip to main content

Table 1 Nucleotide sequences of the qPCR primers and probes used in the present study

From: Reduction in C-terminal amidated species of recombinant monoclonal antibodies by genetic modification of CHO cells

  Forward primer Reverse primer Probe
PAM GGCCGGATCCAATGTTTCAGAA TCCCAAATGACGCATGTTTAATCTCT CTGACACCAAAGAATTT
ACTB AGCCACGCTCGGTCAG CATCCTGCGTCTGGACCT CCGGGACCTGACAGACT
GAPDH CTGATTTTTCTTGCGTCGAGTTT GAGTTGTGTTTGTGGACGAAGTAC TCCGGTAAGACCTTTCG
EF1 CCTGGAATGGTGGTTACCTTTG CATGGTGCATTTCAACAGACTTTACT CCAGTCAACGTTACAACAGA
G6PD ACAACATTGCCTGTGTGATCCT CCCAAATTCATCAAAGTAGCCC CCACGACCCTCAGTACCA
  1. PAM, peptidylglycine amidating monooxygenase; ACTB, β-actin; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; EF1, elongation factor 1; G6PD, Glucose-6-phosphate dehydrogenase.