Skip to main content

Table 1 Primers used in the amplification of shRNA pools from sorted cell

From: Flow cytometry-based functional selection of RNA interference triggers for efficient epi-allelic analysis of therapeutic targets

Primer sequence Id Info
CCGAGGTGGGCAGTCAATCAATCT DK633outerr outer primer
ACGCCATTTTGCAAGGCAT DK637altouterf outer primer
454-adaptor primers   
Lowercase letters provide a multiplexing code to allow separate PCR reactions to be pooled and sequenced together
GCCTCCCTCGCGCCATCAGagcTTTCTTGGGTAGTTTGCAGTTT DK621ACodeAGC ‘A’ type, nested
GCCTCCCTCGCGCCATCAGtgaTTTCTTGGGTAGTTTGCAGTTT DK621ACodeTGA ‘A’ type, nested
GCCTCCCTCGCGCCATCAGcagTTTCTTGGGTAGTTTGCAGTTT DK621ACodeCAG ‘A’ type, nested
Type A primers are identical except for the 3 nt’s in small letters
GCCTTGCCAGCCCGCTCAGtactgacTTGTACAAGAAAGCTGGGTAAG DK622BCodeTActgaC ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGtacgatcTTGTACAAGAAAGCTGGGTAAG DK622BCodeTAcgatC ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGtacagtcTTGTACAAGAAAGCTGGGTAAG DK622BCodeTAcagtC ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGtagactcTTGTACAAGAAAGCTGGGTAAG DK622BCodeTAgactC ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGtagcatcTTGTACAAGAAAGCTGGGTAAG DK622BCodeTAgcatC ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGtacgtacTTGTACAAGAAAGCTGGGTAAG DK622BCodeTAcgtaC ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGtagctacTTGTACAAGAAAGCTGGGTAAG DK622BCodeTAgctaC ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGtagtcacTTGTACAAGAAAGCTGGGTAAG DK622BCodeTAgtcaC ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGcactgagTTGTACAAGAAAGCTGGGTAAG DK622BCodeCActgaG ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGcacgatgTTGTACAAGAAAGCTGGGTAAG DK622BCodeCAcgatG ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGcacagtgTTGTACAAGAAAGCTGGGTAAG DK622BCodeCAcagtG ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGcagactgTTGTACAAGAAAGCTGGGTAAG DK622BCodeCAgactG ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGcagcatgTTGTACAAGAAAGCTGGGTAAG DK622BCodeCAgcatG ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGcacgtagTTGTACAAGAAAGCTGGGTAAG DK622BCodeCAcgtaG ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGcagatcgTTGTACAAGAAAGCTGGGTAAG DK622BCodeCAgatcG ‘B’ type, nested
GCCTTGCCAGCCCGCTCAGcagtcagTTGTACAAGAAAGCTGGGTAAG DK622BCodeCAgtcaG ‘B’ type, nested
Type B primers are identical except the 7 nt’s in small letters.