Skip to main content

Table 2 Primers and oligos used in this study

From: An asymmetric PCR-based, reliable and rapid single-tube native DNA engineering strategy

Primer Sequence(5′-3′) Comments
KanR-F agctatgaccatgattacgGGCccTAGCGGTCACGCTGCGCGTAACC Underlined is the artificial ApaI (GGGCCC) site; the two primers were for amplifying 1.6 kb kanR cassette from pIRES2-EGFP
KanR-R gtcgacctgcaggcatgcaagctt CAAACGACCCAACACCGTGCG
KanR-Right-15 atcatggtcatagct incremental homolog length from 15 bp to 45 bp
KanR-Right-20 ccgtaatcatggtcatagct
KanR-Right-25 agggcccgtaatcatggtcatagct
KanR-Right-30 ccgcta gggcccgtaatcatggtcatagct
KanR-Right-35 cgtga ccgcta gggcccgtaatcatggtcatagct
KanR-Right-40 cgcag cgtga ccgcta gggcccgtaatcatggtcatagct
KanR-Right-45 ttacg cgcag cgtga ccgcta gggcccgtaatcatggtcatagct
KanR-F-2 kb agctatgaccatgattacgggccc AACCAATAGGCCGAAATCGGC incremental insert length
KanR-F-2.5 kb agctatgaccatgattacgggccc TCGCCGACCACTACCAGCAG
KanR-F-3 kb agctatgaccatgattacgggccc ACCGGGGTGGTGCCCATCC
KanR-F-4 kb agctatgaccatgattacgggccc GGCATTATGCCCAGTACATGACC
pF(3.8 kb) gctcgagatc tgcgatctaa gtaagcttgg CATCATTAAACTTCTGACAAGCC 3.8 kb porcine MSTN promoter region
pF(2.3 kb) gctcgagatc tgcgatctaa gtaagcttgg GTGCCATGAGTATTGATTCTGGAG 2.3 kb porcine MSTN promoter region
pR(promoter) catggtggctttaccaacagtaccggaatg CGCCAAGCAAAATTTTAATGCC porcine MSTN promoter region
P1R(promoter) ttagatcgcagatctcgagc 3′ outermost primer for promoter
pF(1.4 kb) gcagacatga taagatacat tgatg GGTTCATTACTTCCTAAAACATGG porcine MSTN terminator
P1R(terminator) CATCA ATGTATCTTA TCATGTCTGC 3′ outermost primer for terminator
MSTN-P-F gaattcgagctcggtacccgg CATCATTAAACTTCTGACAAGCC construction of porcine MSTN expression cassette driving the expression of EGFP
MSTN-P-Right ccgggtaccgagctcgaattc
MSTN-T-Right gaccatgattacgccaagctt