Skip to main content

Table 1 Primers used in this study

From: Development of a diagnostic method for neosporosis in cattle using recombinant Neospora caninum proteins

Primer name Sequence (5’– 3’)
GRA2SfiNcoFor ACGGCCCAGCCGGCCATGGCCGATTTTTCT
GRA2NotHisBack TCTGCGGCCGCATTGACTTCAGCTTCT
GRA2NotHisFor AGTCAATGCGGCCGCGGTCGAGCACCACCA
SbfI-His4Back ACATCCTGCAGGTCAGTGGTGGTGGTG
FLAGSfiFor GACTACAAGGATGACGATGACAAGGCGGCCCAGCCGGCCA
SRS2SfiNcoFor CGGCCCAGCCGGCCATGGCGCCGTTCAAGT
SRS2NotBack TCTGCGGCCGCGGGGGAATCGCCGTTCTCT
CACC-bx-FLAG-HRV3C Forward CACCATGAAGATACTCCTTGCTATTGCATTAATGTTGTCAA CAGTAATGTGGGTGTCAACAGACTACAAGGATGACGATGAC AAGGGTGCACTTGAAGTCCTCTTTCAG
SAG1Forword TATGGTACCGATCAGAAAAATCACCTCTA
SAG1Reverse ATAGAGCTCTCACGCGACGCCAGCCGCTAT