Skip to main content

Table 1 Primers used in the cloning or mutagenesis experiments

From: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method

Primer name Primer description Primer sequence
pGEMHEStartRev Reverse primer for pGEMHE vector with start codon CATGGCCAAAGTTGAGCGTTTATTCTG
pGEMHEStopFwd Forward primer for pGEMHE vector with stop codon TAAACCAGCCTCAAGAACACC
p3X14startRV Reverse primer for p3xFlag-cmv-14 vector with start codon CATGGTGGCGAATTCGCGGCCGCAAGC
p3X14endFW Forward primer for p3xFlag-cmv-14 vector GGATCCCGGGCTGACTAC
HEstartFW-p3X14 Forward primer for ECSCR cloning into p3xFlag-cmv-14 CGAATTCGCCACCATGGGCACCGCAGGAGC
HEendRV-p3X14 Reverse primer for ECSCR cloning into p3xFlag-cmv-14 AGTCAGCCCGGGATCCAAGAACCTTCTCTGCTGAGAG
HTR3A5P381_5A5 Forward primer of HTR3A for 5 Pro mutated to Ala CGCTGCCGCAGCAGCTCGGGAGGCCTCGCTG
HTR3A5P381_5A3 Reverse primer of HTR3A for 5 Pro mutated to Ala GAGCTGCTGCGGCAGCGCTACATCTGTCCCTCGGG
pLXSN3'fwd Forward primer for pLXSN vector GGATCCGGCTGTGGAATGTG
pLXSN5'rev Forward primer for pLXSN vector GAATTCCGGCGCCTAGAGAA
Akt3v1&2Start Forward primer for Akt3v1 & v2 with Kozak sequence CTAGGCGCCGGAATTCCATCATGAGCGATGTTACCATTGTG
Akt3v1StopRev Reverse primer for Akt3v1 cloning into pLXSN TTCCACAGCCGGATCCTTATTCTCGTCCACTTGCAGAGTAG
β2β4N_Rv Reverse primer for vector along with N-terminal cDNA GATGATGAGGTTGATGGTGTAG
β2β4C_Fw Forward primer for insert amplification CATCAACCTCATCATCCCCTG
β2StopRv_HE Reverse primer for C-terminal β2 insert amplification CTTGAGGCTGGTTTACTTGGAGCTGGGGGCTG
β4StopRv_HE Reverse primer for C-terminal β4 insert amplification CTTGAGGCTGGTTTAGTCACGCTGGGCAGCGT
AChBPins4Fw Forward primer for AChBP insert4 to α7 nAChR CTTCGAGATCGACCTGAAGACCGACACCGA