Skip to main content

Advertisement

Table 1 Primers used in the cloning or mutagenesis experiments

From: FastCloning: a highly simplified, purification-free, sequence- and ligation-independent PCR cloning method

Primer name Primer description Primer sequence
pGEMHEStartRev Reverse primer for pGEMHE vector with start codon CATGGCCAAAGTTGAGCGTTTATTCTG
pGEMHEStopFwd Forward primer for pGEMHE vector with stop codon TAAACCAGCCTCAAGAACACC
p3X14startRV Reverse primer for p3xFlag-cmv-14 vector with start codon CATGGTGGCGAATTCGCGGCCGCAAGC
p3X14endFW Forward primer for p3xFlag-cmv-14 vector GGATCCCGGGCTGACTAC
CHRNA9Startez Forward primer for CHRNA9 cloning into pGEMHE CTCAACTTTGGCCATGAACTGGTCCCATTCCTGCAT
CHRNA9Stopez Reverse primer for CHRNA9 cloning into pGEMHE TCTTGAGGCTGGTTTAATCCGCTCTTGCTATGATCAAA
CHRNB2qk5 Forward primer for CHRNB2 cloning into pGEMHE GCTCAACTTTGGCCATGGCCCGGCGCTGCGG
CHRNB2qk3 Reverse primer for CHRNB2 cloning into pGEMHE TTCTTGAGGCTGGTTTACTTGGAGCTGGGGGCTG
CHRNA4_qk5 Forward primer for CHRNA4 cloning into pGEMHE GCTCAACTTTGGCCATGGAGCTAGGGGGCCC
CHRNA4_qk3 Reverse primer for CHRNA4 cloning into pGEMHE TTCTTGAGGCTGGTTTAGATCATGCCAGCCAGCC
ECSM2_qk5 Forward primer for ECSCR cloning into pGEMHE GCTCAACTTTGGCCATGGGCACCGCAGGAGC
ECSM2_qk3 Reverse primer for ECSCR cloning into pGEMHE TTCTTGAGGCTGGTTTAAAGAACCTTCTCTGCTGAGAG
HEstartFW-p3X14 Forward primer for ECSCR cloning into p3xFlag-cmv-14 CGAATTCGCCACCATGGGCACCGCAGGAGC
HEendRV-p3X14 Reverse primer for ECSCR cloning into p3xFlag-cmv-14 AGTCAGCCCGGGATCCAAGAACCTTCTCTGCTGAGAG
ZACNqk5 Forward primer for ZACN cloning into pGEMHE GCTCAACTTTGGCCATGATGGCCCTATGGTCCCTG
ZACNqk3 Reverse primer for ZACN cloning into pGEMHE TTCTTGAGGCTGGTTTACAGTCTAGGCCGCCTGC
APBB1qk5 Forward primer for APBB1 cloning into pGEMHE GCTCAACTTTGGCCATGTCTGTTCCATCATCACTGAG
APBB1qk3 Reverse primer for APBB1 cloning into pGEMHE TTCTTGAGGCTGGTTTATGGGGTATGGGCCCCCA
HTR3A5P381_5A5 Forward primer of HTR3A for 5 Pro mutated to Ala CGCTGCCGCAGCAGCTCGGGAGGCCTCGCTG
HTR3A5P381_5A3 Reverse primer of HTR3A for 5 Pro mutated to Ala GAGCTGCTGCGGCAGCGCTACATCTGTCCCTCGGG
pLXSN3'fwd Forward primer for pLXSN vector GGATCCGGCTGTGGAATGTG
pLXSN5'rev Forward primer for pLXSN vector GAATTCCGGCGCCTAGAGAA
Akt3v1&2Start Forward primer for Akt3v1 & v2 with Kozak sequence CTAGGCGCCGGAATTCCATCATGAGCGATGTTACCATTGTG
Akt3v1StopRev Reverse primer for Akt3v1 cloning into pLXSN TTCCACAGCCGGATCCTTATTCTCGTCCACTTGCAGAGTAG
Akt3v2StopRev Reverse primer for Akt3v2 cloning into pLXSN TTCCACAGCCGGATCCTTATTTTTTCCAGTTACCCAGCATGC
β2β4N_Rv Reverse primer for vector along with N-terminal cDNA GATGATGAGGTTGATGGTGTAG
β2β4C_Fw Forward primer for insert amplification CATCAACCTCATCATCCCCTG
β2StopRv_HE Reverse primer for C-terminal β2 insert amplification CTTGAGGCTGGTTTACTTGGAGCTGGGGGCTG
β4StopRv_HE Reverse primer for C-terminal β4 insert amplification CTTGAGGCTGGTTTAGTCACGCTGGGCAGCGT
AChBPins1Fw Forward primer for AChBP insert1 to α7 nAChR CCCGGCCCCACCAAGGACGACCCCCTGACCGTGACCCTGGG CTTCACCCTGCAGGACATCATGGACGTGGATGAGAAGAAC
AChBPins1Rv Reverse primer for AChBP insert1 to α7 nAChR CTTGGTGGGGCCGGGGTACATGGGGCTTCTGTTGAACA GGTCGCTCTTCAGTCTCATCTGGAACTCGCCTTGCAGG
AChBPins2Fw Forward primer for AChBP insert2 to α7 nAChR TGTGGGACCCCAACGAGTACGGCAACATCACCGACTTCAGA ACCAGCGCCGCCGACATTTGGAAACCAGACATTCTTCTCTA
AChBPins2Rv Reverse primer for AChBP insert2 to α7 nAChR TCGTTGGGGTCCCACATCAGGCTGTTCAGCTTCCATCTCT GCTGCTCGTAGTACACGGTGGTTAAAACTTGGTTCTTCTC
AChBPins3Fw Forward primer for AChBP insert3 to α7 nAChR TCGCCGTGGTGACCCACGACGGCAGCGTGATGTTCATCCCCG CCCAGAGACTGAGCTTCATGTGCTACATCGATGTACGCTGG
AChBPins3Rv Reverse primer for AChBP insert3 to α7 nAChR TGGGTCACCACGGCGATCTGGGGGCTCAGCACCTGCACGGGTC TGGTGCTGCTGTAGGCGGTAATGTCTGGTTTCCAAATGTCGG
AChBPins4Fw Forward primer for AChBP insert4 to α7 nAChR CTTCGAGATCGACCTGAAGACCGACACCGA CCAGGTGGATATCAGTGGCTATATCCCCA
AChBPins4Rv Reverse primer for AChBP insert4 to α7 nAChR CAGGTCGATCTCGAAGCCGCTGTACACCCAGCTG CCGAACTTCACGGCGCAGTGCTGCACATCAAAGG
AChBPins5Fw Forward primer for AChBP insert5 to α7 nAChR TACAGCTGCTGCCCCGAGCCCTACATCGACGTGAA CCTGGTGGTGAAGTTCCGCCGCAGGACACTCTAC
AChBPins5Rv Reverse primer for AChBP insert5 to α7 nAChR CGGGGCAGCAGCTGTAGTGCTGCACCTGTCTGGTCT GGGTGGCGCTCAGGATGTCCCATTCTCCATTGGGGA