Skip to main content

Table 2 Primer sets and conditions used in quantitative real-time PCR (qPCR)

From: Upregulation of CYP 450s expression of immortalized hepatocyte-like cells derived from mesenchymal stem cells by enzyme inducers

Gene Genbank
Accession
Sense primer
5'----- > 3' (Tm°C)
Antisense primer
3'----- > 5' (Tm°C)
Size amplicon (bp) Annealing temp. (°C) Putative function
ALB NM_000477 TGAGAAAACGCCAGTAAGTGAC (60.8) TGCGAAATCATCCATAACAGC (58.7) 265 60 albumin
AFP NM_001134 GCTTGGTGGTGGATGAAACA (60.4) TCCTCTGTTATTTGTGGCTTTTG (59.2) 157 60 α-fetoprotein
CK18 X12881 GAGATCGAGGCTCTCAAGGA (62.4) CAAGCTGGCCTTCAGATTTC (60.4) 357 60 cytokeration 18
G6PD U01120 GCTGGAGTCCTGTCAGGCATTGC (68.1) TAGAGCTGAGGCGGAATGGGAG (66.4) 349 60 glucose-6-phosphate dehydrogenase
HNF-4α AY680696 GCCTACCTCAAAGCCATCAT (60.4) GACCCTCCCAGCAGCATCTC (66.5) 256 60 hepatocyte nuclear factor 4α
TAT NM_000353 TGAGCAGTCTGTCCACTGCCT (64.5) ATGTGAATGAGGAGGATCTGAG (60.8) 338 60 tyrosine aminotransferase
CYP2B6 NM_000767 ATGGGGCACTGAAAAAGACTGA (60.8) AGAGGCGGGGACACTGAATGAC (66.4) 283 60 Cytochrome P450 2B6
CYP2D6 NM_000106 CTAAGGGAACGACACTCATCAC (62.7) GTCACCAGGAAAGCAAAGACAC (62.7) 289 60 Cytochrome P450 2D6
CYP2C9 NM_000771 CCTCTGGGGCATTATCCATC (62.4) ATATTTGCACAGTGAAACATAGGA (57.7) 137 60 Cytochrome P450 2C9
CYP2C19 NM_000769 TTCATGCCTTTCTCAGCAGG (60.4) ACAGATAGTGAAATTTGGAC (54.3) 277 60 Cytochrome P450 2C19
CYP2C8 NM_000770 ACAACAAGCACCACTCTGAGATATG GTCTGCCAATTACATGATCAATCTCT 100 60 Cytochrome P450 2C8
CYP3A4 AK298451 GCCTGGTGCTCCTCTATCTA (62.4) GGCTGTTGACCATCATAAAAGC (60.8) 187 60 Cytochrome P450 3A4
CYP1A1 BC023019 TCCAGAGACAACAGGTAAAACA (58.9) AGGAAGGGCAGAGGAATGTGAT (62.7) 371 60 Cytochrome P450 1A1
CYP1A2 AF182274 ACCCCAGCTGCCCTACTTG (64.5) GCGTTGTGTCCCTTGTTGT (62.4) 101 60 Cytochrome P450 1A2
CYP2E1 NM_000773 ACCTGCCCCATGAAGCAACC (64.5) GAAACAACTCCATGCGAGCC (62.4) 246 60 Cytochrome P450 2E1
PXR AB307701 GAAGTCGGAGGTCCCCAAA (62.3) CTCCTGAAAAAGCCCTTGCA (60.4) 100 60 pregnane × receptor
CAR AB307702 TGATCAGCTGCAAGAGGAGA (60.4) AGGCCTAGCAACTTCGCACA (62.4) 102 60 constitutive androstane receptor
AhR BC070080 ACATCACCTACGCCAGTCGC (64.5) TCTATGCCGCTTGGAAGGAT (60.4) 101 60 aryl hydrocarbon receptor
UGT1A1 BC128414 GGAGCAAAAGGCGCCATGGC (62.5) GTCCCCTCTGCTGCAGCTGC (64.5) 178 60 uridine diphosphate glucuronyltransferase 1A1
LV-BMI-1 NM_005180 GCTGAGGGCTATTGAGGCGCA (65.5) ACCCCAAATCCCCAGGAGCTGT (65.7) 127 60 lentivirus vector BMI-1
hBMI-1 NM_005180 ACCTCCCAGCCCCGCAGAAT (65.9) AGACGCCGCTGTCAATGGGC (66.4) 280 60 human BMI-1
LV-hTERT AF018167 CAACCCGGCACTGCCCTCAG (66.9) GGGGTTCCGCTGCCTGCAAA (68.2) 268 60 lentivirus vector telomerase reverse transcriptase
hTERT AF018167 CGGAAGAGTGTCTGGAGCAAGT (59.5) GAACAGTGCCTTCACCCTCGA (61.1) 258 60 human telomerase reverse transcriptase
  1. Sequence of the primers and the conditions used in quantitative real-time PCR (qPCR).