Skip to main content

Table 1 MiRNAs, PCR primers and synthetic templates

From: Specific and sensitive quantitative RT-PCR of miRNAs with DNA primers

miRNA Sequence Forward primer Reverse primer Synthetic template
let-7a UGAGGUAGUAGGUUGUAUAGUU GCAGTGAGGTAGTAGGTTGT GGTCCAGTTTTTTTTTTTTTTTAACTATAC CAGGTCCAGTTTTTTTTTTTTTTTAACTATACAACCTACTACCTCA
let-7d AGAGGUAGUAGGUUGCAUAGUU AGAGAGGTAGTAGGTTGCAT AGGTCCAGTTTTTTTTTTTTTTTAACT CAGGTCCAGTTTTTTTTTTTTTTTAACTATGCAACCTACTACCTCT
miR-20a UAAAGUGCUUAUAGUGCAGGUAG ACAGTAAAGTGCTTATAGTGCA GTCCAGTTTTTTTTTTTTTTTCTACCT CAGGTCCAGTTTTTTTTTTTTTTTCTACCTGCACTATAAGCACTTTA
miR-21 UAGCUUAUCAGACUGAUGUUGA TCAGTAGCTTATCAGACTGATG CGTCCAGTTTTTTTTTTTTTTTCAAC CAGGTCCAGTTTTTTTTTTTTTTTCAACATCAGTCTGATAAGCTA
miR-23a AUCACAUUGCCAGGGAUUUCCA CATCACATTGCCAGGGAT CGTCCAGTTTTTTTTTTTTTTTGGAA CAGGTCCAGTTTTTTTTTTTTTTTGGAAATCCCTGGCAATGTGAT
miR-23b AUCACAUUGCCAGGGAUUACCAC same as for miR-23a TCCAGTTTTTTTTTTTTTTTGTGGTA CAGGTCCAGTTTTTTTTTTTTTTTGTGGTAATCCCTGGCAATGTGAT
miR-25 CAUUGCACUUGUCUCGGUCUGA CATTGCACTTGTCTCGGT GGTCCAGTTTTTTTTTTTTTTTCAGA  
miR-26a UUCAAGUAAUCCAGGAUAGGCU CGAGTTCAAGTAATCCAGGA CCAGTTTTTTTTTTTTTTTAGCCTATC CAGGTCCAGTTTTTTTTTTTTTTTAGCCTATCCTGGATTACTTGAA
miR-27a UUCACAGUGGCUAAGUUCCGC CAGTTCACAGTGGCTAAGA CAGTTTTTTTTTTTTTTTGCGGAA CAGGTCCAGTTTTTTTTTTTTTTTGCGGAACTTAGCCACTGTGAA
miR-101a UACAGUACUGUGAUAACUGAA CGCAGTACAGTACTGTGATAAC AGGTCCAGTTTTTTTTTTTTTTTCAG CAGGTCCAGTTTTTTTTTTTTTTTCAGTTATCACAGTACTGTA
miR-103 AGCAGCAUUGUACAGGGCUAUGA AGAGCAGCATTGTACAGG GGTCCAGTTTTTTTTTTTTTTTCATAG  
miR-122 UGGAGUGUGACAAUGGUGUUUGU ACAGTGGAGTGTGACAATG TCCAGTTTTTTTTTTTTTTTCAAACAC CAGGTCCAGTTTTTTTTTTTTTTTACAAACACCATTGTCACACTCCA
miR-125b UCCCUGAGACCCUAACUUGUGA CAGTCCCTGAGACCCTA GTCCAGTTTTTTTTTTTTTTTCACAA CAGGTCCAGTTTTTTTTTTTTTTTCACAAGTTAGGGTCTCAGGGA
miR-139b-5p UCUACAGUGCACGUGUCUCCAGU TCTACAGTGCACGTGTCT GTCCAGTTTTTTTTTTTTTTTACTGGA CAGGTCCAGTTTTTTTTTTTTTTTACTGGAGACACGTGCACTGTAGA
miR-150 UCUCCCAACCCUUGUACCAGUG GTCTCCCAACCCTTGTAC GTCCAGTTTTTTTTTTTTTTTCACTG CAGGTCCAGTTTTTTTTTTTTTTTCACTGGTACAAGGGTTGGGAGA
miR-199b-3p UACAGUAGUCUGCACAUUGGUU CAGTACAGTAGTCTGCACAT GTCCAGTTTTTTTTTTTTTTTAACCAA CAGGTCCAGTTTTTTTTTTTTTTTAACCAATGTGCAGACTACTGTA
miR-200b UAAUACUGCCUGGUAAUGAUGA ACAGTAATACTGCCTGGTAATG GGTCCAGTTTTTTTTTTTTTTTCATC CAGGTCCAGTTTTTTTTTTTTTTTCATCATTACCAGGCAGTATTA
miR-200c UAAUACUGCCGGGUAAUGAUGGA AGTAATACTGCCGGGTAATG GTCCAGTTTTTTTTTTTTTTTCCATC CAGGTCCAGTTTTTTTTTTTTTTTCCATCATTACCCGGCAGTATTA