Skip to main content

Table 2 Primer sequences used in the screening of transgenic insect cell lines expressing Gag protein.

From: Use of the piggyBac transposon to create HIV-1 gag transgenic insect cell lines for continuous VLP production

Primer pair Product
sense CTAAATTGTAAGCGTTAATATTTTG
antisense GGTAGCGACCCCCTCAGCCAATAAGAATTC
Product 1 (3'ITR and 3' end of gag)
sense: GGGTTAATCTAGCTGCATCAGGATC
antisense: GAGCGCACGAGGGAGCTTC
Product 2 (5' ITR)
sense: CTGGGATGGGTGGGTTGCTGG
antisense:CTTCTGAGAGCTCGATCGATAC
Product 3 (Junction between neomycin and gag)
sense ATGGGTGCTCGCGCATCTATCC
antisense ATTCTTGGCTGAGGGGGTCGC
Gag
sense GCGGTACCATGATTGAACAAG
antisense CGGAGCTCTCAGAAGAACTCG
Neomycin
sense CAGTTACCAATGCTTAATCAG
antisense GTATGAGTATTCAACATTTCCG
Ampicillin